1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dovator [93]
3 years ago
9

I need help asap

Biology
1 answer:
soldi70 [24.7K]3 years ago
3 0

longer than those emitted by the sun

Explanation:

The earth's surface emits primary wavelengths whose wavelengths are longer than those emitted by the sun.

They are called long wave radiation because they are less energetic and have longer wavelength higher than those visible light.

  • most of the radiation emitted by earth surface is the infra-red region.
  • when this radiation enters the atmosphere back, it causes the warming of the troposphere.
  • The sun emits energetic short wave radiations.

learn more:

Sun's energy brainly.com/question/1140127

#learnwithBrainly

You might be interested in
Which organelle packages proteins and sends them from one area of a cell to another
iVinArrow [24]
The answer is a photo but I can’t see them
3 0
3 years ago
Science<br><br><br>look at the picture ​
LenKa [72]
Wowwwwwwwwwwwwwwwwwwwwww
4 0
2 years ago
Most scientists agree that there is no single ______________ for solving problems
Alexeev081 [22]

Most scientists agree that there is no single <u>solution</u> for solving problems.

4 0
4 years ago
Mutations and variations are<br> 1:willed into existence <br> 2:random
mihalych1998 [28]

Answer:

2:random

Explanation:

Mutations are RANDOMLY caused by mistakes in the DNA replication process there is no telling when they will happen, nor is there a way to force mutations!

If correct PLEASE give brainliest and a thanks! But you do not have to!

Thanks,

andrewschneider05

6 0
3 years ago
If an earthworm is 18 mm long and it is photographed and the picture is magnified 2.5x how long will it be in the picture?
romanna [79]

Answer:

 length of earthworm in picture will be 45 mm. Hope this helps you.

5 0
3 years ago
Other questions:
  • Is the amount of energy stored in a molecule of atp compared to the amount stored in a molecule of glucose greater?
    8·1 answer
  • Genetic continuity is maintained through asexual reproduction because
    11·1 answer
  • 3. What is another name or a sub-property of cohesion? Give an example of how this affects living
    12·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • Inside a star, the force of gravity is balanced by the?
    6·2 answers
  • The words underlined above are the key processes of the exploration. Complete the following sentences. Transcription produces .T
    15·2 answers
  • if you wanted to use a radioactive or fluorescent tag to label only the RNA in a cell and not the DNA what molecules would you l
    13·1 answer
  • Which of the choices below is the best comparison of commensalism with parasitism?
    5·1 answer
  • What is always the last step in a food chain or food web?
    5·1 answer
  • The genetic code of a strand of dna is determined by a specific sequence of
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!