1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliina [53]
3 years ago
7

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’

Biology
1 answer:
stepladder [879]3 years ago
7 0

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

You might be interested in
Place the following events in muscle contraction in the correct sequence from first to last. 1. ATP binds to myosin head. 2. Myo
sladkih [1.3K]

Answer:

The correct sequence of muscle contraction from first to last is given below

Explanation:

step 1  myosin head interacts with actin

step 2 ATP binds to myosin head

step 3  ATP is converted to ADP and Pi

step 4  ADP and pi are released from myosin

step 5  Myosin head pivots in the power stroke

step 6  Myosin head is cocked back.

7 0
2 years ago
How many ATP is there in the Krebs cycle?
Finger [1]

Answer:

there are two ATP molecules

5 0
3 years ago
Read 2 more answers
One rabbit run faster than other rabbits in a population. How will the ability to run fast most likely benefit the rabbit? pls h
photoshop1234 [79]

Answer and Explanation:

The ability to run faster will help benefit the rabbit by being able to escape predators that will try to eat them.

If you are faster than the thing that is trying to eat you, then you have a higher chance of surviving.

<em><u>#teamtrees #PAW (Plant And Water)</u></em>

7 0
2 years ago
Read 2 more answers
a cell placed in a solution shrinks by the process of osmosis. what kind of solution is outside the cell?
nordsb [41]
The anser is what you doing 
8 0
3 years ago
Rank the order in which the earliest organisms evolved.
Black_prince [1.1K]

The order in which the earliest organisms evolved -

  • Archaea and bacteria
  • Protists
  • Fungi and shell-less invertebrates
  • Green algae
  • Shelled Invertebrates

On the earth, various kinds of organisms evolve at different geological times, and on their evolution, they consider the oldest or youngest organisms:

  • Archaebacteria and bacteria was the oldest living organism on earth was, they lacked a membrane-bound nucleus and cell.
  • The protists evolved after the bacteria, they were multicellular prokaryotic organisms.
  • Fungi and the shell-less invertebrate, much-developed organisms in terms of body organization and structure. These have membrane-bound, well-defined cell membranes, and a nucleus. They even had a tissue level of organization.
  • Green algae evolve after protists which belong to the division Thallophyta of the plant kingdom. These are photosynthetic as they have chlorophyll in the cell.
  • Shelled Invertebrates are the youngest organisms that evolved recently among these.

Thus, the correct order is -

  • Archaea and bacteria
  • Protists
  • Fungi and shell-less invertebrates
  • Green algae
  • Shelled Invertebrates

Learn more about geological time scale:

brainly.com/question/16528968

5 0
3 years ago
Other questions:
  • True or false? phosphate is released as rocks and sediments wear down
    9·1 answer
  • Which of the following structures is where cellular respiration occurs in a cell
    7·1 answer
  • The frontal and parietal bones of the skull are especially susceptible to
    9·1 answer
  • Which of the following statements is TRUE regarding a basic amino acid? The positively charged R group of a basic amino acid cou
    7·1 answer
  • Neurons have _ forms<br><br> A) Different <br> B) the same
    11·1 answer
  • actual question! lol. . Animals marking their territory with urine is an example of _______.. a.. competition. b.. predation. c.
    14·2 answers
  • Which of these changes produces a chemical change?
    7·1 answer
  • Which of the following most likely supports the most sustainable ecosystem?
    8·2 answers
  • if placed in tap water, an animal cell will undergo lysis, whereas a plant cell will not. what accounts for this difference?
    13·1 answer
  • What can help climate change the least?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!