1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliina [53]
3 years ago
7

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’

Biology
1 answer:
stepladder [879]3 years ago
7 0

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

You might be interested in
(HELP FAST PLEASE)! This weather map showed the temperature in( •F) in the untied states on a winter day it also includes two pr
Komok [63]
Kill a ijmkjijih,ohh,iugggkiu
5 0
3 years ago
What component of Earth’s atmosphere exists entirely as a result of photosynthesis?
ryzh [129]
Salutations!

What component of Earth’s atmosphere exists entirely as a result of photosynthesis?

Oxygen is the component of Earth's atmosphere that is existed entirely as a result of photosynthesis. Photosynthesis is a procedure that plants and other different organisms use sunlight to make their food. It is a chemical procedure.

Hope I helped (:

Have a great day!
3 0
3 years ago
If a population has low death rates and high life expectancy which end of the population pyramid will increase?
Eduardwww [97]

Answer: "Constrictive" pyramid

[ I hope my answer is correct]

6 0
3 years ago
Compared to terrestrial plants, what challenges do aquatic plants have to overcome in order to carry out photosynthesis?
Ganezh [65]
I don't know answer, but my answer is the leaf segments, whole communities, and plant dominated aquatic ecosystems and present contemporary methods tailor made to quaintly photosynthesis and carbon fixation underwater.
8 0
3 years ago
Electrons are excited in photosystem I. What do these electrons combine with in order to produce an energy-carrying molecule?
Elenna [48]
Below are the choices that can be found elsewhere:

a. ADP 

<span>b. ATP </span>

<span>c. glucose </span>

<span>d. NADP+
</span>
The answer is d. NADP+ 
<span>The electrons combine with NADP+ molecules to form NADPH molecules. The NADPH molecules then travel to the stroma of the chloroplast to carry out the Calvin cycle. The Calvin cycle then produces glucose, which is the energy carrying molecule. The glucose molecule is used in cellular respiration to make ATP, so the cell can harness the energy from the glucose molecule.</span>
6 0
3 years ago
Read 2 more answers
Other questions:
  • Why would a doctor suggest converging lenses to correct a patient’s vision?
    7·2 answers
  • Where does meiosis take place in bryophytes
    15·1 answer
  • If the concentration of glucose is higher outside the cell than inside,then what will happen by the process of diffusion
    6·1 answer
  • How can these artificial reefs protect biodiversity in the ocean ecosystem?
    8·2 answers
  • which statement correctly describes a way that mutations increase the likelihood that a species will survive in a changing envir
    14·1 answer
  • Please help me
    7·1 answer
  • Study the graph carefully. Notice that exergonic reactions result in products of lower energy. This increases entropy. Justify a
    8·2 answers
  • Genetic Variation and Evolution Quick Check
    5·1 answer
  • Explain why it would not be possible to accurately measure hemoglobin concentration if the RBCs were not first lysed
    8·1 answer
  • What is heart in the human body​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!