1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliina [53]
3 years ago
7

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’

Biology
1 answer:
stepladder [879]3 years ago
7 0

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

You might be interested in
How are photosynthesis and chemosynthesis similar ?
creativ13 [48]
Processes by which organisms produce food
7 0
3 years ago
Read 2 more answers
In this lesson, you have learned that the stomach is an organ in the digestive system that is made up of different tissues that
k0ka [10]

Answer:

The whole body works together, as a “team.”If one of the parts of the body won’t work together as a team, everything will get messed up. The stomach muscles churn and mix the food with digestive juices that have acids and enzymes, breaking it into much smaller, digestible pieces. An acidic environment is needed for the digestion that takes place in the stomach.

Explanation:

6 0
3 years ago
Read 2 more answers
A single strand of dna has bases attccga. how would the bases of the complementary strand read?
suter [353]
One strand show ATTCCGA so the other will show TAAGGCT !
5 0
3 years ago
Protein synthesis is a multistep process. put the steps of protein synthesis in sequential order.
wlad13 [49]

Answer:

Replication - Transcription - Translation

Explanation:

Replication duplicates the DNA so that happens first. Then in transcription converts the DNA to mRNA which goes to the cytoplasm to make proteins. In translation proteins are made when codons and anti codons join to make amino acids which create the proteins.

6 0
2 years ago
Interphase consists of what part of the cell cycle?
LuckyWell [14K]

Answer:

This is DNA replication

Explanation:

G1 --> S --> G2 --> PMAT

6 0
2 years ago
Other questions:
  • Which chemical is added to many municipal water supplies to prevent tooth decay
    7·2 answers
  • Dna replication makes a(n) ________ copy of the dna strand, while transcription makes a(n) ________ copy of the dna strand.
    6·1 answer
  • What are environmental pressures for a rabbit, cactus, shark, and giraffe?
    11·1 answer
  • Your coworker is known to have diabetes and begins to act tired. he becomes confused and loses the ability to sit up and swallow
    14·2 answers
  • Write a 600 word report discussing nuclear reactors. The report should include a description of the way a reactor works and the
    9·1 answer
  • All of the following statements are true regarding active transport except for one. Which statement does not apply to active tra
    14·1 answer
  • In the human life cycle
    14·1 answer
  • One way to determine the density of animals in an area is to use the mark-recapture technique. A number of individuals from a po
    14·1 answer
  • All of the following are products of cellular respiration except
    10·1 answer
  • Popular building stone
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!