1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliina [53]
4 years ago
7

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’

Biology
1 answer:
stepladder [879]4 years ago
7 0

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

You might be interested in
A group of students decide to repeat the hershey and chase experiment with modifications. they decide to radioactively label the
Oxana [17]
Would not be to distinguish between labeled DNA and amino acids.
4 0
3 years ago
What is the nutritive fluid flowing through the circulatory system? A. Lymph B. Blood C. Pus D. Water
xenn [34]

Answer: The answer is blood

Explanation:

The blood is the 'fuel' of the circulatory system in that it carries nutrients ranging from

- gases like oxygen by the help of its respiratory pigment, hemoglobin

- rich food substances like glucose, amino acids to various cells of the body

- antibodies and hormones that provide defence against invaders

Thus, the blood is the nutritive fluid of the circulatory system

3 0
3 years ago
What makes amino acids different from each other
Anuta_ua [19.1K]

Answer:

Something called side groups

Explanation:

The side groups are what make each amino acid different from the others. Of the 20 side groups used to make proteins, there are two main groups: polar and non-polar. These names refer to the way the side groups, sometimes called "R" groups, interact with the environment.

6 0
3 years ago
What are Mitosis Similarities to Meiosis?
Cloud [144]
Meiosis and mitosis both have the nuclear membrane that breaks down as the DANA organizes into chromosomes
5 0
3 years ago
Which of these best describes the relationship between smoke from factories and acid rain?
Aleksandr-060686 [28]

Answer:

C

Explanation:

A  Smoke travels directly into clouds, creating acid rain.

B  Smoke turns clouds black, which causes them to become more acidic and release  black acid rain.

с  Smoke increases greenhouse gases, which make the water in clouds more acidic  so they release acid rain.

D  Smoke wipes out all the greenhouse gases in the atmosphere, increasing the  acidity of clouds so they create acid rain.

<em>The correct answer would be that </em><u><em>smoke increases greenhouse gases, which make the water in clouds more acidic  so they release acid rain. </em></u>

A typical smoke consists of a mixture of gases, including greenhouse gases like methane, water vapor, and some oxides of acids. Hence, smoke has the capacity to cause acid rain because it increases the concentration of greenhouse gases in the atmosphere. These gases dissolve in rainwater, causing it to form a weak solution of acid.

The correct option is C.

6 0
3 years ago
Other questions:
  • Is pulmonary embolism an infectious or non infectious disease?
    11·2 answers
  • Which of the follwing is not a characteristic of life​
    8·1 answer
  • Top left 1
    12·1 answer
  • Oven cleaner is a highly caustic chemical that reacts with baked on foods. It is dangerous to the touch and has a very slippery
    12·2 answers
  • Who was the individual whose three principles led to a better understanding of the
    14·1 answer
  • A dichotomous key is a _____. 3 choice key 1 choice key 4 choice key 2 choice key
    9·2 answers
  • What would happen if we didn't have subcutaneous fat
    7·1 answer
  • Why are the three 3 functions of the white blood cells important?
    6·1 answer
  • What might happen to the rate of diffusion if the blood flow were to speed up?
    10·1 answer
  • All vertebrate embryos have _____ at some point during embryonic development, indicating a common evolutionary ancestor
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!