1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliina [53]
4 years ago
7

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’

Biology
1 answer:
stepladder [879]4 years ago
7 0

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

You might be interested in
Which of the following activities is an example of humans overexploiting natural resources? Choose 1 answer: Choose 1 answer: (C
ratelena [41]
A. The burning of large quantities of fossil fuels which take millions of years to replenish
6 0
3 years ago
Which of the following is an abiotic part of a river that will affect the organisms that currently live in a river?
Mkey [24]
C because the plants in the fuller is now
6 0
3 years ago
The coyote will become the apex predator and
xz_007 [3.2K]

Answer:

No, coyote will not become the apex predator.

Explanation:

No, coyote will not become the apex predator but greatly reduces the populations of foxes in order to reduce competition for available resources. Yes, The coyote population will decreases because t he gray wolf kills coyote to avoid competition for food resources. If another wolf is introduced to fit the same ni che, the coyote population will decrease because the wolf feeds on coyote. As the number of coyotes increase, the number of beavers will decrease because coyote feeds on beaver. If the gray wolf became extinct,  the coyote population increases in that location due to no predator.

7 0
3 years ago
Why are many cells wired together in a typical photovoltaic panel
Harrizon [31]
It would have been easier to answer the question if there would have been some options to choose from. I am answering the question based on my knowledge and hope that it helps you. Many cells are wired together in a typical photovoltaic panel because of increasing the amount of electricity generated. 
7 0
3 years ago
Read 2 more answers
WILL GIVE BRAINLIEST Which description accurately describes the tide represented by the image below?
seropon [69]

Answer:

the system creates a moderate high tide

4 0
4 years ago
Other questions:
  • In a negative feedback mechanism what helps in correcting the change
    10·2 answers
  • If you know that a population is 75% the dominant phenotype and 25% is the recessive phenotype, can you determine approximately
    5·1 answer
  • What processes found at a convergent boundary will help form the following rock? Sedimentary Rocks:
    10·1 answer
  • EXPLAIN THE NATURE OF SCIENCE?​
    5·1 answer
  • What are some strategies that can help erin identify high-fiber whole-grain foods when she shops?
    14·1 answer
  • What are Methamphetamines???
    10·2 answers
  • Which trophic level does a fish represent in this food chain? algae S mosquito larva S dragonfly larva S fish S man
    15·1 answer
  • A scientist studying the oxygen concentration in sealed chambers containing cultured plant cells finds that when the chambers ar
    8·1 answer
  • HELP ME PLZZZZZZZZZZZZ Clark decides to measure the volume of a rock he found outside. He fills a graduated cylinder with water
    6·1 answer
  • Which of these methods of waste management is most likely to release
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!