1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliina [53]
4 years ago
7

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’

Biology
1 answer:
stepladder [879]4 years ago
7 0

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

You might be interested in
What is the process of water moving down through the soil called?
Alisiya [41]

Answer:

The answer is B the girl is wright

4 0
4 years ago
How does a mouse obtain energy for everyday functions? How might this look different compared to how an own obtains energy?
Gemiola [76]

Answer:

A mouse would obtain energy from plants that have vitamins and minerals, and protein from things like nuts. An owl would get protein from eating a mouse and vitamins and minerals from the things the mouse ate.

Explanation:

It's all one big circle. These nutrients would provide the energy needed to perform everyday tasks.

7 0
3 years ago
Write a sentence explaining the connection between each pair of words carbohydrate, mitochondria
Rashid [163]

Answer:

Carbohydrate and mitochondria are closely connected with each because carbohydrate is a food substance from which energy is extracted by the mitochondria of the cell. Mitochondria is called the power house of the cell. Its main function is to make energy for the cell which used this energy to perform various function by using food material such as carbohydrate. So we can say that both are connected with each other.

5 0
4 years ago
A blood disorder caused by a lack of iron and red blood cells is called
vekshin1
Anemia is a blood disorder caused by a lack of iron and red blood cells.

Anemia impedes the production of protein hemoglobin in the body because of the absence or lack of the mineral iron in the blood. Iron is needed to produce the protein hemoglobin which in turn helps the red blood cells carry oxygen from the lungs and transport it all throughout the body.
5 0
4 years ago
A gland that aids in the production and release of sperm is called
Anvisha [2.4K]

Answer:

The Testes.

Explanation:

Testes are contained in a sac of skin called the scrotum, it produces sperm, then make hormone testosterone. It aids testosterone which promotes the development of secondary sexual characteristics, which in humans include a deeper voice, more body hair, and more powerful muscles than that in their counterparts which are the female.

4 0
3 years ago
Other questions:
  • Which eubacteria help plants in the production of proteins?
    8·2 answers
  • How many times do you vomit with the stomach flu reddit?
    9·1 answer
  • Unlike a eukaryotic cell, a prokaryotic cell does not have
    10·1 answer
  • What is the procedure the describes the steps you use during an experiment?
    9·1 answer
  • A(n) _________lapse is the recurrence of a disease or symptoms after apparent recovery. In other words, the symptoms or disease
    10·1 answer
  • The plasma membrane is _____.
    6·1 answer
  • To which skeletal system do the carpals belong to?
    15·2 answers
  • The top layer of Earth is called soil.<br> True or false
    14·2 answers
  • (iii) Write one function of each Microbe used in clean technology:
    11·1 answer
  • What is the cell membrane made of? Check all that apply.
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!