1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliina [53]
3 years ago
7

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’

Biology
1 answer:
stepladder [879]3 years ago
7 0

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

You might be interested in
Why does the relationship between metabolic rate and temperature exist?
Andre45 [30]
C.there is no relationship between metabolic rate and body temperature.
4 0
3 years ago
What evidence is there for evolution?
jarptica [38.1K]

The evidence would be all the different types of species

5 0
3 years ago
Answer these questions
Darya [45]
1. <span>Rain occurs when water vapor condenses

</span><span>2. The best term to use to describe turning from a liquid to a gas is </span><span>vaporization

</span><span>3. When you add heat energy to a liquid it turns into a gas</span>
3 0
3 years ago
Why will other ecosystems be affected if freshwater ecosystems dry up?
vagabundo [1.1K]

Answer: a

Explanation:

7 0
2 years ago
How is the energy in ATP released so that it may be used to drive cellular processes?
Kitty [74]
 All life depends on capturing energy from the sun and converting it in to a form that living organisms  can use.
- Two key processes (mirror each other)
- Photosynthesis (Sun -> Plants)
<span>- Cellular respiration (Plants/Animals/energy)</span>
3 0
3 years ago
Other questions:
  • There are sepecies of fish that have more dna than humans true or false
    12·1 answer
  • What are limitations in Science? I need this urgently plz helppppp
    12·1 answer
  • Why does the sun appear to move from east to west across the sky​
    11·1 answer
  • According to the graph below, at which point is the plant preforming the least photosynthesis?
    8·2 answers
  • A means of communicating information or art is called artistic​
    5·2 answers
  • Which statements describe the governmental importance of the Clean Air Act? Check all that apply.
    11·2 answers
  • How does material move from the respiratory system to the circulatory system? answers?
    7·2 answers
  • If a strand of DNA has the nucleotide sequence: AATGCT, what is the complementary sequence of RNA nucleotides that would be made
    10·1 answer
  • Which of the following best describes how scientists
    11·1 answer
  • In what molecule does the energy from these high-energy electrons end up
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!