1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliina [53]
3 years ago
7

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’

Biology
1 answer:
stepladder [879]3 years ago
7 0

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

You might be interested in
Energy pyramid: An energy is a graphical model of energy flow of energy community
Andru [333]

1) Each level losses<u> 90% </u>of energy that was contained in the previous level. 2)Protozoa (Producer), snail, shrimp, amphipods (Primary consumers), Salamander (Secondary consumer), Intestinal roundworm (Tertiary consumer), fungi (Decomposer).

<h3>What is the 10% rule in trophic webs?</h3>

The 10% rule states that at each trophic level occurs an energy transference from one of the levels to the next, with only 10% being usable in each of them.

As a general rule, only about 10% of the energy stored as biomass at one trophic level -per unit time- ends up as biomass at the next trophic level -in the same unit of time.

The remaining 90% of energy is lost to the environment as heat.

The progressive reduction of energy determines the number of trophic levels (4 or 5).  

In the xposed example,

1) Each level losses<u> 90% </u>of energy that was contained in the previous level.

2)

  • 1st level: Protozoa ⇒ Producer
  • 2nd level: snail, shrimp, amphipods ⇒ Primary consumer
  • 3rd level: Salamander ⇒ Secondary consumer
  • 4th level: Intestinal roundworm ⇒ Tertiary consumer
  • 5th level: fungi ⇒ Decomposer

You can learn more about the 10% rule at

brainly.com/question/18254335

#SPJ1

8 0
1 year ago
Which of these is least likely to be an adaptation?
zvonat [6]
In this case the answer would most likely be C, good luck !!
5 0
3 years ago
An opening between the right and left atria that's present in fetal mammals is the
pshichka [43]
It is the Foramen Ovale. The foramen ovale is a little gap situated in the septum between the two upper councils of the heart. The foramen ovale is utilized amid fetal dissemination to accelerate the go of blood through the heart. 
The one fatal cardiac shunts, the other being the ductus arteriosus. Another comparative adjustment in the embryo is the ductus venous. In many people, the foramen ovale closes during childbirth.
7 0
3 years ago
Which of the following are responsible for surface currents?
Len [333]

the answer is wind and the earths rotation

I got it right

6 0
3 years ago
Read 2 more answers
Which of the following can be used to determine the general location of radioactively labeled dna
Annette [7]

The Geiger Counter .

6 0
3 years ago
Read 2 more answers
Other questions:
  • During the contraction of a vertebrate skeletal muscle fiber, calcium ions _____.
    8·1 answer
  • If DNA replication continues as illustrated, which statement MOST accurately describes the expected results? A) One strand of re
    8·2 answers
  • How does heredity affect a species
    5·1 answer
  • Osmosis is taking place when water molecules move in all of the following situations except when
    13·2 answers
  • Which factors affect the rate of deposition? Check all that apply
    9·2 answers
  • The allele for the hair pattern called widows peak is dominant over the allele for no widows peak. In a population of 1000 indiv
    10·1 answer
  • What is scientific method?
    10·1 answer
  • Help me plz i really need to finish this
    9·2 answers
  • During the hot, dry African summer months, African clawed frogs can dig one-foot deep burrows into the mud. The frogs leave a sm
    13·1 answer
  • Select the correct compound.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!