1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliina [53]
4 years ago
7

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’

Biology
1 answer:
stepladder [879]4 years ago
7 0

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

You might be interested in
How does the respiratory system work as defense system?
tia_tia [17]

Answer:

The cilia is one of the things that act defensively in the respiratory system.

Explanation:

It propels a mucus-like liquid that covers the airway which traps pathogens (potentially infectious microorganisms) and other particles, preventing them from reaching the lungs.

4 0
3 years ago
In the evolutionary adaptation sense what is fitness?
Jobisdone [24]
Is this a college question
6 0
4 years ago
2. In dogs, there is a hereditary type of deafness caused by a recessive gene. Two dogs who carry the
Ludmilka [50]
Theres the answer hope you can see it

5 0
3 years ago
Read 2 more answers
Helppp Pleaseee Ill give u pointssss
Ksenya-84 [330]

Answer:

I think it is F.

Explanation:

6 0
3 years ago
Read 2 more answers
Why is the opiate morphine likely to be administered after major surgery?
nordsb [41]
To suppress pain and stress.
3 0
3 years ago
Other questions:
  • Please can anyone help me with these questions (16, 17, 18, and 19)?
    14·2 answers
  • A group of the same kind of cells is called __________.
    14·2 answers
  • Describe how a flu vaccine protects the human body.
    9·1 answer
  • Karen horney's psychoanalytic theory focused more on ____________ than did sigmund freud's. biological factors involved in perso
    14·1 answer
  • Which phrase best describes cellular respiration? A. the process where energy from food is used by the cell B. the process where
    11·2 answers
  • What type of cell changes to fit where needed?​
    13·1 answer
  • Which is not a characteristic of homologous chromosomes? A. Same length B. Same centromere position C. Exact same type of allele
    12·1 answer
  • Coat color in rabbits is represented by a gene (C). The different phenotypes are dominant in this order: Agouti > chinchilla
    12·1 answer
  • How are carbon dioxide and oxygen exchanged in the lungs?
    13·1 answer
  • A bacteria cell a plant cell and animal cell have which structure in common
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!