1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliina [53]
3 years ago
7

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’

Biology
1 answer:
stepladder [879]3 years ago
7 0

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

You might be interested in
What gas made up the largest portion of earth's atmosphere for most of earth's history
kipiarov [429]

Gases in Earth's Atmosphere. Nitrogen and Oxygen are by far the most common. Dry air is composed of about 78% Nitrogen (N2) and about 21% Oxygen (O2). Argon, Carbon Dioxide (CO2), and many other gases are also present in much lower amounts; each makes up less than 1% of the atmosphere's mixture of gases.

So therefore Oxygen is the gas that makes up the largest portion of the Earths Atmosphere.

7 0
3 years ago
Which of the following reasons explains a possible advantage of using adult stem cells in therapeutic cloning rather than embryo
denis23 [38]
The answers are A and d
6 0
3 years ago
Which changes would most likely limit the growth of a plant-eating animal population?
gayaneshka [121]
Probably if there are not enough plants in that area
5 0
3 years ago
Match each rock with the correct description.
Sergio039 [100]

Answer:

quartizide - 5

limestone - 1

shale - 3

basalt - 4

sandstone - 2

correct me if im wrong.

8 0
3 years ago
Read 2 more answers
What is the last stage of river flow
Dovator [93]
I believe the answer is delta.
8 0
3 years ago
Other questions:
  • CO₂ is an example of a compound. True or false?
    8·1 answer
  • What type of cell is osmosis (ozzie)jones
    11·2 answers
  • Chromosomes other than sex chromosomes are known as _____. autosomes alleles genes proteins
    10·2 answers
  • Match the following. Match the items in the left Colin to the items in the right column.
    11·1 answer
  • The San Andreas Fault is known for which of the following?
    6·1 answer
  • An organism's genetic makeup (alleles) is known as its?
    5·2 answers
  • Help
    8·1 answer
  • Scientists use bacteria to make ________
    15·2 answers
  • Compare sexual and asexual reproduction
    14·1 answer
  • Both dna and rna ________. naturally occur as a double helix are highly reactive catalysts in cells are information-containing m
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!