1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliina [53]
3 years ago
7

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’

Biology
1 answer:
stepladder [879]3 years ago
7 0

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

You might be interested in
The density of solid aluminum is 2.70 . If a 1g piece of aluminum is dropped in a cup of water, it will . (The density of water
Olegator [25]
Sink to the bottom because it is more dense than the water.
3 0
3 years ago
Which kind of electrical charge is found on a hydrogen atom of a polar water molecule
irina1246 [14]

<span>Explanation: Oxygen is the more electro-negative of the atoms in the water molecule, so it tends to pull the 'shared' electron more to itself. Thus, the oxygen atom has a greater time-share of all electrons, and therefore the hydrogen atoms are more positive for a partial lack of electrons</span>

<span />

8 0
2 years ago
Where do bile and pancreatic enzymes enter the small intestine?
BartSMP [9]

Answer:

The correct answer is duodenum

Explanation:

Bile is a digestive enzyme that is secreted by the liver which is temporarily stored in the gall bladder and pancreatic enzyme is released by the pancreas. The bile is secreted to the small intestine through the common bile duct and the pancreatic duct joins the common bile duct just before ampulla of Vater which opens in the first intestinal portion which is duodenum.

So bile and pancreatic enzymes enters the duodenum region of the small intestine and after getting in the small intestine it digests the complex macromolecules into simpler and smaller form which can be absorbed through the intestinal epithelium.  

7 0
3 years ago
enkephalin-induced depression of single neurons in brain areas with opiate receptors—antagonism by naloxone
kicyunya [14]

Induced depression of single neurons in brain areas with opiate receptors

  • Enkephalin, applied microiontophoretically, depressed spontaneous and glutamate-induced firing of  one neuron in frontal cortex, caudate nucleus, and periaqueductal gray matter, where enkephalin and high concentrations of opiate receptors are met.
  • More than one depressions were blocked by the specific narcotic antagonist naloxone. The results  are durable with a neurotransmitter or neuromodulator role for this new brain pentapeptide.
  • Opium derivatives have been in medical use for the last  2000 years, and may be   longer than any other class of drugs
  • . The brain regions which was  involved in these actions have been identified in some instances by local microinjection of pmole quantities of opioids.

To know more about neurons    visit : brainly.com/question/24217914

#SPJ4

8 0
1 year ago
Although the Cell Theory is widely accepted and well supported, what might happen to cause it change?
Sliva [168]

Answer:

By doing more research.

Explanation:

The cell theory change with the passage of time by doing more research about the cell. The final modification of the cell theory done by Rudolf Virchow in 1855 on the basis of his new research and findings about the cells.    With the passage of time, modification occurs in microscope which enable the scientists to find different parts, organelles and features of cell on the basis of which scientists modify cell theory with the passage of time.

7 0
2 years ago
Other questions:
  • Does the ANIMAL CELL have FLAGELLA / CILIA?<br> A. Yes<br> B. No
    9·1 answer
  • Select all that apply. Which of the following are functions of stems?
    5·1 answer
  • What is the relationship between science and pseudoscience
    15·1 answer
  • A description of natural events that has been proven to be true time after time, without exception.
    8·1 answer
  • SOMEONE HELP MEEEEEEE PLEASE ILL GIVE 50 POINTS AND BRAINLIEST,
    5·2 answers
  • Krypton is named after the Greek word that means “secret.” Which explains why krypton was most likely given this name? Krypton i
    15·2 answers
  • Which is part of the theory of evolution by natural selection?
    9·1 answer
  • What name is given to the process that restores the diploid number of chromosomes?
    12·1 answer
  • Which of the following protists are correctly paired with their mode of locomotion? euglenas, cilia amoebae, flagella volvox, ps
    12·1 answer
  • In which case is potential energy increasing?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!