1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliina [53]
3 years ago
7

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’

Biology
1 answer:
stepladder [879]3 years ago
7 0

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

You might be interested in
At the end of meiosis I each cell has __________ the number of chromosomes as was in the original cell.
goldfiish [28.3K]
A. At the end of meiosis I each cell has twice the number of chromosomes as was in the original cell.
4 0
2 years ago
(word bank)
choli [55]

Answer:

Sulfur; nitrogen.

Explanation:

Acid precipitation results when sulfur and nitrogen compounds react with water in the atmosphere.

This acid precipitation is also known as acid rain and it is typically caused by the chemical reaction between sulfur oxide and nitrogen oxide which are released into the air as a result of burning fossil fuels, with water and other chemical elements present in the atmosphere.

Generally, acid precipitation (acid rain) usually have a pH of about 5.1 or below and as such, it is very acidic nature i.e possessing a large amount of hydrogen ions.

Hence, acid precipitation (acid rain) when washed to the earth has negative or harmful effects on various living and non-living organisms such as animals, plants, cars, buildings etc.

5 0
2 years ago
What are three things that affect an enzymes activity
andriy [413]

Answer:

oofooooooofofofo29u4844

6 0
3 years ago
Read 2 more answers
A Ferris wheel has a mechanical advantage of ___________________________ one and the trade off is that it covers a greater dista
Anna35 [415]

Answer:

A. less than one

Explanation:

The Ferris wheel was designed by  George Washington Gale Ferris Jr in 1893. It consist of a large rotating wheel with capsules or cars that are used to carry people.

The mechanical advantage is less than one because the input force is greater than the output force.

3 0
3 years ago
Why is high blood pressure damaging to the heart?
mart [117]
E fdg dgr dgr d gd rgdrg dhh 
3 0
2 years ago
Other questions:
  • Exploring how indoor air pollutions lead to respiratory problems is an example of using biology to what
    9·1 answer
  • If there was a sudden drop in temperature after the evolution of the first living cells, predict how that might have affected th
    7·1 answer
  • Which of the following represents an ion? (1 point)
    9·1 answer
  • What happens when you move the microscope stage in different directions?
    5·2 answers
  • The phylum with endoderm, mesoderm, and ectoderm is
    14·1 answer
  • What is a situation where your sympathetic nervous system would be active? Give me an example from real life.
    8·1 answer
  • Name any four animals which take careof their babies​
    6·1 answer
  • what is the name of the process in bacteria that involves dna transfer through a cytoplasmic connection known as a pilus?
    12·1 answer
  • A solution with a pH of 7
    12·1 answer
  • Producers, such as those that make the foods that are shown below, make glucose during the process of photosynthesis.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!