1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliina [53]
3 years ago
7

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’

Biology
1 answer:
stepladder [879]3 years ago
7 0

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

You might be interested in
If air resistance is ignored, then according to the law of conservation of energy, the sum of potential energy and kinetic energ
laiz [17]
Would be same everywhere !! mechanical energy is always constant !

and it doesn't matter air is present or not....total energy is always constant !
7 0
4 years ago
A sunflower is an angiosperm, and a gingko is a gymnosperm. Which best describes the life cycles of sunflowers and gingkoes? I.
dalvyx [7]

The correct statements are I, III and IV.

An angiosperm refers to a plant, which exhibits flowers and generates seeds enveloped within a carpel. The angiosperms include a large group of herbaceous plants, grasses, shrubs, and the majority of trees. While gymnosperms refer to the plants that exhibit seeds but not safeguarded by any kind of fruit or ovary. It includes the cycads, gingko, and conifers.

Both the angiosperm (sunflower) and gymnosperm (gingko) are seed-bearing plants. However, the seeds of a sunflower are safeguarded by a flower or fruit, while for the gingko, there is no mechanism like that, i.e, there is not any kind of protection. Additionally, sunflower exhibit phenomenon of double fertilization, which is not witnessed in the case of gingko.


7 0
4 years ago
A group of hikers find a fallen tree in a forest. The dead tree trunk is covered by mushrooms and other fungus. Later, they find
Evgen [1.6K]
D! They are both decomposing dead organic matter and metabolizing it through certain pathways to obtain energy! Hope this helped :)

7 0
3 years ago
Read 2 more answers
List five reasons to explain why the leaf is specialized for its function.​
kirza4 [7]

Answer:

has transparent epidermis to allow light to pass for photosynthesis

has chlorophyll to trap sunlight energy needed in photosynthesis

has stomata to allow passage of water and gases

6 0
3 years ago
Which statement best describes both insulin and glucagon?]
Basile [38]

Answer:

if the questions are They both provide structural support, but only insulin is a carbohydrate.

They both store energy, but only glucagon is a carbohydrate.

They are both hormones that regulate blood-sugar levels.

They are both hormones that help fight disease

I can only confirm the answer isnt the first choice i think its the 2nd

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is a physical change? A newspaper burns when placed in a fire. An iron chair rusts when left outside. A s
    6·2 answers
  • How can an increase in carbon dioxide affect an ecosystem’s average temperature?
    10·1 answer
  • Do prokaryotic cells have nucleic acid?
    6·1 answer
  • A heterozygous tall pea plant is crossed with a short pea plant. The probability that an F1 plant will be tall is :
    14·2 answers
  • Part A A researcher notices that in a certain moth species, some females prefer to feed and lay eggs on domesticated solanaceous
    5·2 answers
  • Pablo and Johanna have to do a yearlong study for their biology course. After some discussion, they decide to try comparing thei
    7·1 answer
  • Help me plz i really need to finish this
    9·2 answers
  • What is the main problem associated with metal refining?
    6·2 answers
  • Prokaryotic cells do not have a distinct nucleus and are missing other organelles. This is a characteristic of which domains?
    5·1 answer
  • Where do daughter cells come from
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!