5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’

1 answer:

7 0

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

You might be interested in

An atom that loses or gains electrons and ends up being positively or negatively charged is called

shepuryov [24]

This becomes an Ion.

3 0

3 years ago

An important organelle is missing from this image of a eukaryotic cell undergoing protein synthesis. This organelle is not surro

MatroZZZ [7]

<span>This organelle is the nucleolus. The nucleolus is made of proteins, DNA, and RNA. They form around specific regions of the chromosomes called nucleolar organizing regions. These regions of the chromosomes contain some the genes needed for ribosome production.</span>

4 0

3 years ago

Read 2 more answers

Can someone please help me? :(

bearhunter [10]

Answer: 5… I think

Explanation: sorry if I’m wrong.

4 0

3 years ago

Which of the following describes the effort arm?

Colt1911 [192]

Answer: