1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliina [53]
4 years ago
7

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’

Biology
1 answer:
stepladder [879]4 years ago
7 0

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

You might be interested in
Mycelia produced in asexual reproduction are _____.
algol [13]
Ur Answer is: Fungi...
7 0
3 years ago
Why is a lack of oxygen fatal to cells?
sveticcg [70]
Oxygen is a vital element within cellular respiration. An intrinsic part of the cellular respiration cycle is the transfer or electrons through the electron transport chain, and at the end of it exists the mitochondria, in which electrons are donated to the Oxygen and combine with hydrogen ions to form water.
6 0
4 years ago
Which of the following results from cutting down trees
ZanzabumX [31]

Answer:

D

Explanation:

Vegetation on soil protects the soil from erosion because its roots and root hairs help bind the soil particles together. This occurs mechanically by binding soil into crumbs and also chemically by providing organic matter that binds the soil particle into humus that holds moisture. The soil becomes heavy to be carried off by wind erosion. Trees also break the down flow of water hence reducing the capacity of runoff to carry soil sediments.

4 0
3 years ago
Read 2 more answers
A plant with purple flowers is allowed to self-pollinate. Generation after generation, it produces purple flowers. This is an ex
Virty [35]

Answer:

True breeding

Explanation:

True breeding is a breeding in which parents produce the offspring which carry same phenotype.  

The parents in true breeding are homozygous for every trait.  

<u>True breeding occurs in the plants when the plants produce offspring of same variety only when self pollination takes place.  </u>

<u>For example, if a plant has purple flowers will produce only seeds which will grow into plants which have purple flowers.</u>

7 0
3 years ago
Which are true?
Pavel [41]

Answer:

C, D, E

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • Can someone help me to fill in the blanks?
    14·1 answer
  • Which is not a characteristic of living things?
    12·2 answers
  • Ossification of the ends of long bones ________. Ossification of the ends of long bones ________. is produced by secondary ossif
    8·1 answer
  • What are two advantages of setting up instruments for measuring carbon dioxide on top of mauna loa​
    12·1 answer
  • The first crops most likely to have been planted by Neolithic people were:
    13·2 answers
  • Which factor does not predict early maturation in girl? having a mom who reached menarche at a young age having an unhappy child
    8·1 answer
  • Why are sugars and chlorophyll in the same parts of the plant?
    15·1 answer
  • State any one way of controlling the spread of ringworms among children​
    12·1 answer
  • The explosive force of a volcanic eruption depends on the type of magma in the magma chamber. The type of magma depends on its _
    12·2 answers
  • Maya made the following list comparing the differences between the reproductive organs in plants and animals, but she made a mis
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!