1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliina [53]
3 years ago
7

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’

Biology
1 answer:
stepladder [879]3 years ago
7 0

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

You might be interested in
What is the allele frequency
Semmy [17]

Answer:

the relative frequency of an allele at a particular locus in population

Explanation:

5 0
3 years ago
Which is an abiotic factor that characterizes the taiga biome?
Oksana_A [137]
I think I’ll go with C. long dry cold winters
5 0
3 years ago
Read 2 more answers
In plant cell what does the vacuole do
photoshop1234 [79]
<span>I found this on a website..... Hope this helped :)

"In plant cells, the vacuoles are much larger than in animal cells. When a plant cell has stopped growing, there is usually one very large vacuole. Sometimes that vacuole can take up more than half of the cell's volume. The vacuole holds large amounts of water or food."</span>
4 0
3 years ago
Read 2 more answers
7. In the pocket mice investigation, what patterns in the data did you observe? Does the pattern in the
Korvikt [17]

Dark fur color appears to be an adaptation for mice living in dark environments, as both the frequency of the characteristic and the allele that generates it have altered. These findings further back with the theory that selection is context-dependent, as dark mice were preferred in some contexts but not in others.

<h3>What is mutation?</h3>

A mutation is defined as a change in the sequence of genetic letters, called bases, within a molecule of DNA.

In a population, more offspring are born than can survive, resulting in competition among people. Individuals that possess a certain trait are more likely to live and/or produce more offspring than those who do not possess that trait. The context in which a species exists influences its selection. Characteristics that are advantageous in one setting may be detrimental in another.

New mutations cause black color.

  1. Fur color is controlled by many genes (4:29).
  2. Most genes are identical, but dark and light rock
  3. pocket mice differ in one gene (Mc1r; 4:55).

For more information regarding mutations, visit:

brainly.com/question/17031191

#SPJ1

8 0
1 year ago
Why does a female’s cervix dilate prior to delivering a baby?
cluponka [151]

Effacement: The cervix – which is normally long and thick, measuring about 1-2 inches, starts to get shorter and thinner. This process is known as effacement. As the cervix gets more and more effaced, it gets shorter and shorter and “pulled up” into the lower part of the uterus.

Dilation: At the same time, the cervix softens and begins to open up – known as dilation. This widening, allows a smooth passage for the baby’s head and the rest of the body from the uterus into the vaginal canal.

5 0
3 years ago
Other questions:
  • The region of the optic nerve lacking photoreceptor cells is known as the ________.
    5·1 answer
  • What is responsible for abo blood types
    9·1 answer
  • Plants make their own food from photosynthesis, what is this food called?
    13·2 answers
  • which three types of cells are part of ground tissue storing food conducting photosynthesis and provinding support
    15·1 answer
  • The treelike fibers that receive information and send it toward the neuron's cell body are called ____
    10·1 answer
  • Which is the pair of the enzyme activities most significantly affected by glucagon- and insulin-dependent phosphorylation and de
    14·1 answer
  • Where does almost all energy for food come from
    10·1 answer
  • Why do we group artworks with similar characteristics into periods or styles?
    5·2 answers
  • Which mantle is under the crust the upper mantle or the lower mantle
    9·2 answers
  • How does the term “selectively permeable” apply to a membrane?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!