1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliina [53]
3 years ago
7

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’

Biology
1 answer:
stepladder [879]3 years ago
7 0

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

You might be interested in
PLZ HELP me...im struggling
PIT_PIT [208]
If D is dominant and d is recessive

1. Dd
2. DD
3. dd
4 0
3 years ago
What is mainly NOT fossil fuels in developing
Natalka [10]
The answer to ur question is A
6 0
3 years ago
Which farming practice causes the least harm to
Valentin [98]
Using Natural predators to reduce insect numbers caused the least harm to the environment.
4 0
3 years ago
Read 2 more answers
Which of the following is not an inherited trait of a plant?
kirill [66]
I am not totally sure but I think it’s B
6 0
3 years ago
From a single fertilized ovum undergoing a series of rapid cell divisions, a human infant develops. The embryonic cells become s
weeeeeb [17]

Answer:

Answer is C

Explanation:

Each cell has an identical copy of DNA with enzymes controlling the expression of specific genes leading to a variety of cells

3 0
3 years ago
Other questions:
  • Why is the ability to move important to animals
    14·1 answer
  • Diferenta dintre structura si forma craniului visceral la mamifere si pasari ?
    6·2 answers
  • Ventifacts are created by a process of erosion called
    15·1 answer
  • Can you count how old the tree was?
    8·2 answers
  • What is the advantage of crossing-over?
    15·1 answer
  • The earth's continents move at certain times of the year due to the motions of the tectonic plates. True or false
    14·2 answers
  • A method used by horticulturalists when they rotate the use of fields—planting crops on a particular piece of land for a period
    14·1 answer
  • If you observed a cell under a microscope and saw that it contained a plasma membrane, cell wall, and ribosomes, but no other or
    10·2 answers
  • Helium has an atomic number of two so for its outer energy level is full. Helium is considered
    14·1 answer
  • No links and i know this isn't actually biology
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!