1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliina [53]
3 years ago
7

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’

Biology
1 answer:
stepladder [879]3 years ago
7 0

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

You might be interested in
What is the process by which genetic material is copied?
Pepsi [2]
I would think it’s DNA replication
Hope that helped
Sorry if it’s wrong
6 0
2 years ago
ur data for diffusion of water across a differentially permeable membrane in response to a sucrose gradient could be graphed wit
musickatia [10]
The slopes show that sucrose gradient affects change in weight.

The slopes will be different because higher gradient concentration of sucrose will result in the higher amount of water moved. This means the higher sucrose gradient concentration, the more change in weight of the water. 
6 0
2 years ago
Where would you expect to find green algae? Choose three answers
Andrei [34K]
On rocks in the sun under moving or stagnant water
6 0
2 years ago
Q: What is wrong with
vagabundo [1.1K]

Answer:

Explanation:

they can not chose to adapt. adaptations occur over a very long period time(darwinism)  Evolution is not selective in the sense that the organism being changed can choose.

3 0
2 years ago
Two stores sell CDs in packages, as shown in the table below.
vova2212 [387]

Answer:

10. 50 ehaisnenhsiwolen br isiwokneb

5 0
3 years ago
Other questions:
  • Discuss the interconnections of the cardiovascular system with each of the other major body systems introduced. Give specific ex
    14·1 answer
  • How did scientist use changes in organisms living on the planet to create the geologic time scale
    6·2 answers
  • The fossil record is testament to extinct fauna no longer present on Earth. Certain areas of the planet have always had high spe
    5·1 answer
  • DNA if it is a sequence of only four letters
    5·2 answers
  • Which is the relationship between plants and oxygen?
    12·2 answers
  • How many total, non-unique alleles are there for each gene in a population of 400 humans?
    11·1 answer
  • Large eyes that are forward provide better ______
    10·1 answer
  • PLZ ANSWER QUICKLY, WILL GIVE BRAINLIEST
    14·1 answer
  • Which of the following is the best way to slow the greenhouse effect? drive more often stop using electricity use energy sources
    8·2 answers
  • 1. Describe the flow of energy from the sun to a producer, like grass, and then to a consumer, like a rabbit. 100 points!!! Not
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!