1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LUCKY_DIMON [66]
4 years ago
8

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG

Biology
1 answer:
zhenek [66]4 years ago
5 0

Answer:

Met-Cys-Arg-Asn-Ser-Arg-Stop

M-C-R-N-S-R-Stop

Explanation:

Using the genetic code table, after translation of the RNAm, the resulting peptide will be M-C-R-N-S-R-Stop

CU AUG UGU CGU AAC AGC CGA UGA CCC G

. .   Met  Cys   Arg   Asn   Ser   Arg   Stop .......

You should notice that codon AUG mark the beginning of the future peptide (Met = Methionine). As regards the back extreme, you have to look for UAA, UAG or UGA, which will conclude translation.

You might be interested in
When did genetically modified foods devlop?
Furkat [3]
I believe the are recently new within the last 50 years i would imagine 
6 0
4 years ago
What is the relationship between genetic variation and natural selection?
fredd [130]
Genetic variation is when there are many offspring with different genetics, therefore some offspring might be able to adapt due to its genetics
4 0
3 years ago
Which of the following is considered assimilation in the carbon cycle?
11111nata11111 [884]

Answer:

<u>A plant absorbing carbon dioxide during photosynthesis</u>

Explanation:

Carbon dioxide diffuses from the atmosphere through the stomata across the intercellular spaces to the chloroplasts during photosynthesis. The carbon dioxide reacts with hydrogen ions forming glucose. The carbon in the atmosphere is assimilated into plants reducing the amount of carbon that might lead to global warming.

3 0
4 years ago
According to Friedman and Roenman, high levels of stress are linked to __________.
Assoli18 [71]
The answer is emphysema
8 0
3 years ago
Respond to the following based on your reading.
Zepler [3.9K]

Answer:

  1. <em>The water cycle is driven primarily by the energy from the sun. This solar energy drives the cycle by evaporating water from the oceans, lakes, rivers, and even the soil. Other water moves from plants to the atmosphere through the process of transpiration.</em>
  2. <em> Carbon is found in all organic compounds, but that doesn't mean that all compounds that contain carbon are organic.</em>
  3. <em>Nitrogen in the reduced form is the major component of the three most important biological macromolecular structures: (i) proteins/polypeptides, (ii) DNA and RNA, and (iii) polymers of amino sugars.</em>
  4. <em>Water, nitrogen and carbon cycles. Carbon moves from the atmosphere and back via animals and plants. Nitrogen moves from the atmosphere and back via organisms. Water moves on, above, or below the surface of the Earth.</em>

<em></em>

<em></em>

<em>Hope I helped answer the questions:)</em>

6 0
4 years ago
Read 2 more answers
Other questions:
  • What class of enzymes are involved in triggering events in the cell cycle?
    5·2 answers
  • What is the Coriolis Effect?
    14·1 answer
  • Tom is a football player who gets hit hard from behind along his spine. about a week later, he is diagnosed with bacterial menin
    10·1 answer
  • Adding sodium to chlorine gas will produce table salt.
    14·1 answer
  • Which feature of the earth system is caused by the movement of ions in earths core
    14·1 answer
  • (1) Water is something most of us take for granted. (2) If we need a cold drink or want to take a shower, water is there. (3) If
    13·2 answers
  • If a DNA strand is composed of 30% adenine (A), how much thymine (T) would be present out of 100%?
    7·1 answer
  • How does the fossil record support the theory that all continents used to be connected?
    11·1 answer
  • Last question so help I'll give 50 pts
    6·2 answers
  • Which of the following donot have fossil record ?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!