1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OLga [1]
2 years ago
8

Which of the following donot have fossil record ?

Biology
1 answer:
STatiana [176]2 years ago
4 0

Answer:

D.

Explanation:

Viruses are oftentimes short lasted and disappear quickly.

You might be interested in
The diagram below shows the same model of the greenhouse effect... Which process is NOT AFFECTED by the amount of greenhouse gas
grigory [225]

Answer:

None of them, they are all affected

5 0
3 years ago
Read 2 more answers
5.
kipiarov [429]

Answer:

C. Vaccination

Explanation:

vaccination is the administration of a vaccine to help the immune system develop protection from a disease. Vaccines contain a microorganism or virus in a weakened, live or killed state, or proteins or toxins from the organism.

5 0
3 years ago
Honey vs Sugar which is healthier and why?
Blizzard [7]
Honey has more calories than sugar, so sugar is healthier
5 0
3 years ago
How many times larger is the number of hydrogen atoms than oxygen atoms in a molecule of water, H2O? ______ b. Is this number th
garik1379 [7]

Answer:

The correct answer is- A) two, B) yes, the number is the same as monosaccharides.

Explanation:

There are three atoms are present in a molecule of water which includes two atoms of the hydrogen and one atom of the oxygen. The hydrogen atom is two times larger in the number of the oxygen atom in a single molecule of the water.

In monosaccharides, the ratio of the atoms of carbon, hydrogen, and oxygen is 1:2:1 which means one hydrogen atom would be twice in the number of the carbon and oxygen atoms in a single molecule of monosaccharide molecule.

Thus, the correct answer is - A) two, B) yes, the number is the same as monosaccharides.

3 0
3 years ago
¿cuál es la estructura de la neurona que permite realizar la función de captar estímulos?
Anika [276]
I think it’s D i hope i’m right
3 0
3 years ago
Other questions:
  • When an animal starts breaking down body fat to compensate for a caloric deficiency in its diet, ______________are released into
    11·2 answers
  • All stars one to eight times the sun's mass become ____ stars.
    5·2 answers
  • Which breed of dog is an all around better pet? shar pie or miniature shar pie?
    9·1 answer
  • In your own words explain how a weather ballon can be used to predict-future weather conditions in a location
    7·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • How do the daughter cells produced by mitosis compare to the original cell?
    10·2 answers
  • HURRY PLEASE!! - On Edunity - 20 Points - Might Mark brainliest!!
    5·2 answers
  • Question 9 of 17
    8·1 answer
  • Which is an a word that shows the outlet isn't completely sure about a particular statement
    12·1 answer
  • I NEED HELPPPP PLEASEEE:(
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!