1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatyana61 [14]
4 years ago
13

Explain why capillaries form dense networks in tissues with a high metabolic rate

Biology
1 answer:
natima [27]4 years ago
5 0

<span>  </span>A high metabolic rate means that the cells in the tissue will needs a high rate of gas exchange as the cells will be producing a high amount of CO2 during production of energy.  The dense network of capillaries ensure that the cells are adequately provided with oxygen.                                                                                                                                                                                           

You might be interested in
Which of the following is NOT caused by gravitational force ? A. Gas and dust come together and form a planet. B. Stars cluster
bekas [8.4K]
D sounds correct.......
7 0
3 years ago
Plz help I’m begging plz
mariarad [96]
4

Hope this helps!!:)
7 0
3 years ago
Read 2 more answers
After completing the online activity, what percent of the time did you find that the cell spends in prophase (number of cells in
postnew [5]
28 find that the cell spends in prophase (number of cells in prophase divided by the total # of cells (36) multiplied by 100)
6 0
3 years ago
Read 2 more answers
Class Mammalia is divided into two subgroups: marsupials and placental mammals.
White raven [17]

Answer:

The given statement is false.

Explanation:

The mammals can be differentiated into three main groups on the basis of the development of their babies. These three groups are marsupials, monotremes, and placental mammals, which is the largest group. The monotremes refer to the mammals, which lay eggs. The marsupials refer to the mammals, which give birth to young ones that are not developed completely. While in a placental mammal, the development takes place within the body of a mother until and unless its systems of the body start to work on their own.

3 0
3 years ago
Which global wind belt moves out air masses across the United States?
nata0808 [166]

Answer:

B

Explanation:

hope you have a good day

I found the answer on

6 0
3 years ago
Other questions:
  • How does the insulin pump help a person with type 1 diabetes maintain homeostasis
    8·1 answer
  • State the law of conservation of mass and explain what it means?
    9·1 answer
  • What is mioses it is a science word
    10·2 answers
  • Please help. I need to get these matching answers right.
    12·1 answer
  • Why are recessive alleles not removed from populations over time?
    6·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • ¿Qué sucedería si por una epidemia desaparecieran las golondrinas marinas?
    12·1 answer
  • WILL GIVE BRAINLIEST!!!
    11·1 answer
  • If a cell is placed in hypotonic solution water will flow
    6·1 answer
  • Identify the structures in the celll pictured on the right
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!