A life expectancy of 2 to 5 years less than peers.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
C, energy
to regenerate ATP is the chemical energy stored in food like glucose
We see that this is a region near the continents, so it is probable that there is the boundary of a tectonic plates around there. Since there are islands there, it is quite probable that there is a subduction zone near them which means that the oceanic crust is going below the continental one and the continental is slowly elevated. This also shows that the boundary is convergent, since transform boundaries do not lead to elevation. Near convergent boundaries, there are frequently volcanoes and shallow earthquakes. Finally, the climate near Alaska is cold and this does not depend on whether islands are near a boundary or not. So, 2 4 and 5 are correct.
