1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Semenov [28]
3 years ago
15

Can some one code this dna

Biology
1 answer:
cluponka [151]3 years ago
7 0

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

You might be interested in
Where do the alleles contained in a zygote come from
Eva8 [605]
Hi bunnu5 aka frend can u plz stop marking me brainly I dont even think my answer was right lol and I think somewhere in a chromosomes...
5 0
3 years ago
What is the magnification power of the ocular lens
erica [24]

Magnification is defined as a measure of the ability of a lens or other optical device to magnify a certain image. The ability of a lens to measure size of an object and magnifies to a certain level is the known as a magnification of a lens.

The formula to measure the magnification power of a certain lens is the product of the objective and ocular lens magnification. For example, when using the lower power lens the total magnification is: 10X ocular x10X low power objective = 100X).


6 0
3 years ago
Which is the least specific group? *<br> A. Order<br> B. Class<br> C. Kingdom
ira [324]

Answer:

C. Kingdom

Explanation:

it is the largest and thus the variety is much greater in this group then the rest

4 0
3 years ago
Read 2 more answers
When constructing a Punnett square, the symbols on the outside of the boxes represent _______, while those inside the boxes repr
Veronika [31]

Answer:

The correct answer will be-

1. Genotype of parents (gametes)

2. Genotype of offsprings

Explanation:

6 0
3 years ago
How to find tha answer of the DNA sequence
xxTIMURxx [149]
It’s the first choice because the C at the end does not pair with anything, it was an extra pair that was made
6 0
3 years ago
Other questions:
  • Which human body system is responsible for removing waste products from the body?
    12·2 answers
  • A nurse is providing discharge instructions for a client with a diagnosis of gastroesophageal reflux disease (gerd). what should
    13·1 answer
  • _____ is thermal energy that flows between objects due to a difference in temperture.
    6·2 answers
  • What adaptation does this plant have to thrive in a dry and arid environment?
    7·1 answer
  • Whats a amino acid ?
    13·1 answer
  • 30. How many calories would it take to raise a persons body temperature 3 degrees if their
    5·1 answer
  • What is the primary energy molecule in cells?
    15·1 answer
  • What are limiting factors affecting the African Wild Dogs carrying capacity ?
    13·1 answer
  • What was learned from the pioneer 10
    10·1 answer
  • What is the purpose of cellular respiration?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!