1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Semenov [28]
3 years ago
15

Can some one code this dna

Biology
1 answer:
cluponka [151]3 years ago
7 0

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

You might be interested in
Some meteroites have the same composition as the earths core
Nataly_w [17]
This is very so true
5 0
3 years ago
A DNA strand has mutated! What type of mutation has occured?
velikii [3]

Answer:

b

Explanation:

6 0
3 years ago
How does asexual reproduction limit variation in species?
Delicious77 [7]

Answer:

less of a chance for mutations

Explanation:

6 0
3 years ago
Read 2 more answers
How does the shape of a plant cell differ from an animal cell
Pie
A plant cell is rectangular, while an animal cell is circular.
5 0
3 years ago
Read 2 more answers
Are Sarcomeres made of amino acids?
nevsk [136]

Answer:

A titin mutation that occurs in muscular dystrophy with myositis (mdm) mice results in a predicted 83 amino acid deletion in the N2A and PEVK regions of the titin protein. Muscles from mdm mice are actively more compliant  possibly owing to the deletion in titin's I-band region. This suggests that modulation of titin stiffness in active sarcomeres by the proposed titin–thin filament interaction may be affected by the mdm mutation. The answer is YES I believe.

Explanation:

I believe the answer is yes from my deep reaserch. You may want to research in your texts book/lesson or courses and review what your teacher/professer has given you.

8 0
3 years ago
Other questions:
  • Because it controls the pituitary gland, the brain's _____ ultimately controls the endocrine system.
    7·1 answer
  • Identify the placement of items A-F using the drop-
    9·2 answers
  • How are organisms in the domain archaea different from those in the domain eukarya? A. Archaea have DNA B. Archaea have more tha
    10·1 answer
  • Describe three ways in which the organs of the circulatory system and respiratory system are protected.
    14·2 answers
  • In the water cycle shown above, the two processes that involve water entering the atmosphere are: a. Evaporation and transpirati
    6·1 answer
  • The last area of the brain to fully mature in late adolescence or early adulthood is the
    8·1 answer
  • Where on the earth is the greatest amount of long-term oxygen storage? A) decomposer organisms B) photosynthetic plants C) rocks
    15·1 answer
  • How does the author organize the text or ideas in the article? Check all that apply.
    11·2 answers
  • The end result of succession is a stable ecosystem known as a___________
    13·1 answer
  • The tubes that carry urine from the kidney to the bladder are called the ________
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!