All categories

3 years ago

Can some one code this dna

Biology

1 answer:

cluponka [151]3 years ago

7 0

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand

TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand

GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand

GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand

AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

You might be interested in

Passive transport is the act of a molecule moving freely down its concentration gradient. true or false

raketka [301]

True in passive transport molecules move along concentration gradient from high to low concentration

5 0

3 years ago

All organisms in the kingdom Fungi can be described by which of these characteristics?

loris [4]

Answer:

cell walls made of chitin

Explanation:

Fungal cells differ from mammalian cells in that they have cell walls that are composed of chitin, glucans, mannans, and glycoproteins. Both mammalian and fungal cells have cell membranes; however, they differ in their lipid composition.

8 0

3 years ago

What structure is highly vascular and closely adheres to the surface of the brain?

tatyana61 [14]

Pia mater

<span>Pia mater is a highly vascular tissue that cleaves firmly to the surface of the brain and spinal cord. Pia mater protects the central nervous system by nourishing the brain and allowing blood vessels to pass through it. The inflammation of the pia mater can lead to meningitis</span>

6 0

3 years ago

Read 2 more answers

What is the interrelationship between photosynthesis and cellular respiration?

Kamila [148]

Photosynthesis makes the glucose that is used in cellular respiration to make ATP. The glucose is then turned back into carbon dioxide, which is used in photosynthesis. While water is broken down to form oxygen during photosynthesis, in cellular respiration oxygen is combined with hydrogen to form water.

8 0

3 years ago

Why do X-linked traits appear more often in males

Tpy6a [65]

X - linked traits appear more often in males because males only have one x chromosome. One copy of an x - linked trait is all that a male would need to possess that trait. Females have two x chromosomes, so they would require 2 copies of the x - linked trait in order to possess it.

8 0

3 years ago