1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Semenov [28]
3 years ago
15

Can some one code this dna

Biology
1 answer:
cluponka [151]3 years ago
7 0

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

You might be interested in
Part of a forest area was cleared to build a road. What’s one possible consequence of this clearing? The rate of the growth of t
9966 [12]
Animals will migrate to other places
4 0
3 years ago
Read 2 more answers
Why did biologists in the 1960s recommend reintroducing wolves to Yellowstone?
xxMikexx [17]
It is because that's a place where no one lives so they're safe.
5 0
3 years ago
Every cell in your body was produced through successive rounds of mitosis, starting from the zygote.
MatroZZZ [7]

Answer:

I think that the correct answer is True

6 0
3 years ago
Which of the steps in this sequence of events is an example of mitosis at work?
taurus [48]
<span>The bruise slowly disappears as the arm heals.

</span>
<span>The two identical daughter cells resulting from mitosis and cytokinesis are identical in the following ways:1. Mitosis occurs when the nucleus of the cell divides into two identical nuclei, each with the same type and number of chromosomes. The cell's DNA is duplicated during this phase. Sometimes the cell's DNA isn't copied properly resulting in cancer-type cells. 2. Cytokinesis is when the cytoplasm divides into two identical daughter cells. Each cell is genetically identical and both are a similar size.
</span>
7 0
3 years ago
Read 2 more answers
Catabolism would be best described as a processes that ________. select one:
Anna11 [10]
<span>ctabolism is the process in which complex molecules are broken down into simple ones.</span>
7 0
3 years ago
Other questions:
  • How was genetic engineering able to solve the problem of tomatoes being damaged in transit without sacrificing taste?
    10·1 answer
  • Where in the cell was the ATP produced?
    14·1 answer
  • A loss of _____ of body weight can reduce or prevent the risks associated with obesity.
    5·1 answer
  • Which statement is most true concerning carbon in sediments and rocks? ncdc.noaa.gov They receive the same amount from the ocean
    13·1 answer
  • Find 4 human-related threats to seagrasses. Describe them fully.
    7·1 answer
  • List all wether
    12·1 answer
  • Help me please omggg I need help I am begging y’all
    14·1 answer
  • What is the process of changing to a gas from a liquid
    8·1 answer
  • Ở gà bộ nhiễm sắt thể của loài 2n bằng 78NST .Trong nhân tế bào trứng gà có bao nhiêu NST
    5·1 answer
  • Looking again at the chemical equation for anaerobic respiration in the Introduction of this lab, what is the purpose of anaerob
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!