1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Semenov [28]
3 years ago
15

Can some one code this dna

Biology
1 answer:
cluponka [151]3 years ago
7 0

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

You might be interested in
Help please and thank you :)
Vinil7 [7]

Answer:

A

Explanation:

5 0
3 years ago
Which of the following represents a pricing strategy that establishes a low price in hopes of attracting a great number of custo
professor190 [17]

Answer:  a. penetration strategy

Explanation:

Penetration strategy is one of the marketing strategy to promote the business and enhance the sales. The goods and services are sold at low price initially to promote the production of more goods or merchandise at low cost and allowing the authority to obtain high profit percentage. This method is useful for discouraging the competitors.

7 0
3 years ago
Wendy is a paleontologist and finds a fossil of a bony fish buried in the sediment on the coast. After observing and recording s
antiseptic1488 [7]
The answer is B <span>that bony fish evolved before land plants </span>


6 0
3 years ago
Read 2 more answers
Which of the following will protect against flooding
elena55 [62]
The answer is dams they protect against flooding
7 0
3 years ago
1. Who was Alfred Wegener?
azamat

Answer:

Alfred Lothar Wegener was a German polar researcher, geophysicist and meteorologist. During his lifetime he was primarily known for his achievements in meteorology and as a pioneer of polar research.

3 0
2 years ago
Read 2 more answers
Other questions:
  • How can the polar jet stream influence weather if it dipped farther south over Florida? Explain.
    8·1 answer
  • What abiotic factors have people changed
    13·1 answer
  • How much water are we pumping out of the ground using wells in the US alone?
    14·2 answers
  • 3. The main source of organic matter in soil is<br> A bacteria<br> B fung<br> c plants<br> water
    7·1 answer
  • If a man with one dominant gene for Huntington’s disease marries a women who has no genes for the disease, what is the probabili
    12·1 answer
  • Where are the suns rays least direct
    12·1 answer
  • Sally's brother is color-blinded. her husband is normal. what is the chance for her son to be color-blinded?
    11·1 answer
  • Cell phones use radio waves for communications. What layer of the atmosphere aids in reflecting the radio waves?
    15·2 answers
  • Will not give brainliest! So do ask for it!!<br> Help me with the Live worksheet.
    15·1 answer
  • A codes for brown hair and a codes for red hair. Alternative forms of genes are called:
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!