All categories

4 years ago

Can some one code this dna

Biology

1 answer:

cluponka [151]4 years ago

7 0

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand

TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand

GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand

GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand

AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

You might be interested in

Where do plants get nitrogen mainly from ?

Crank

<span>Plants take nitrogen from the soil by absorbing through there roots as amino acids Most nitrogen obtained trerrestrial animals can be traced back to the eatinf of plants at some stage of the food chain. hope this helps!</span>

7 0

3 years ago

What is the process of water moving from an area of low solute concentration to an area of high solute concentration

gladu [14]

Osmosis is the word your looking for. This answer can also be found on google. This text i found will explain osmosis. Osmosis is the spontaneous net movement of solvent molecules through a semi-permeable membrane into a region of higher solute concentration, in the direction that tends to equalize the solute concentrations on the two sides. ... Osmosis is a vital process in biological systems, as biological membranes are semipermeable.

Please mark this as Brainiest

6 0

4 years ago

Read 2 more answers

in pea plants purple flower color (P) is dominant to white (p) using this information list the genotype and phenotype of the fol

Ne4ueva [31]

Is dominant to White

3 0

3 years ago

WILL BRAINLIEST Genetic variation occurs through genetic recombination.

mestny [16]

Answer:

The diagram, which illustrates a form of genetic recombination, shows that each allele is granted separately to the daughter cells, which is an example of independent assortment.

Explanation:

Crossing over, fertilization and independent assortment are methods of genetic recombination. The diagram (image) states that A-a and B-b are alleles for different characteristics, found in genes and chromosomes.

Independent assortment it was observed for the first time by Gregory Mendel, during his experiments with peas, describing that alleles -the portion of genes that contains variations of specific characteristics- are unrelated to each other and can be distributed independently in the daughter cells.

In this case, thanks to independent assortment, each parent can pass the characteristics of their genotype separately to the offspring -which will have shared characteristics of both- producing genetic variation in species.

Learn more:

brainly.com/question/797676

6 0

4 years ago

Read 2 more answers

There are 32 ____________ that distinguish the buddha, some of which are reflected in the iconography.

Digiron [165]

<span>There are 32 Lakshanas or 32 signs of a great man that distinguish the budha. No one knows what Buddha really looked like. They use clues such as tradition and the fact that he was a Prince to help guide them.Some of the 32 major characteristics, include 40 teeth, gold color skin and deep blue eyes.</span>

6 0

3 years ago