1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Semenov [28]
3 years ago
15

Can some one code this dna

Biology
1 answer:
cluponka [151]3 years ago
7 0

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

You might be interested in
A function of carbohydrates in the diet is to: enable chemical reactions. promote growth and repair of tissues. supply energy. m
astra-53 [7]
<h2>Supply Energy</h2>

Explanation:

  • Carbohydrates, or saccharides, comes under biomolecules. The four significant classes of biomolecules are nucleotides, lipids, proteins and carbohydartes. Among these carbohydrates is more abundant.  
  • It is also called "carbs," carbohydrates have a few jobs in living life forms, including energy transportation. They are the structural parts of insects and plants.
  • Carbohydrates derivatives are engaged with blood clotting, the immune system, the reproduction, the development of disease.

3 0
3 years ago
What two things can happen to pyruvic acid? Explain both
dalvyx [7]

Explanation:

Pyruvic acid supplies energy to living cells through the citric acid cycle (also known as the Krebs cycle) when oxygen is present (aerobic respiration), and alternatively ferments to produce lactic acid when oxygen is lacking (fermentation).Hope it helps

5 0
3 years ago
Why is there chloroplasts in leaf cells but not root cells?
Scilla [17]

Answer:

Chloroplasts are only found in the parts of the plant that are capable of photosynthesis. The majority of chloroplasts are found in the leaves of the plant because these structures have the greatest surface area for absorption. The outer part of a plant stem may also contain chloroplasts.

Explanation:

8 0
3 years ago
Read 2 more answers
In knowledge-based economies, education plays an important role in the lives of citizens and is an important factor in their qua
ELEN [110]

Answer:

B

Explanation:

Just did the assignment and buddy got me wrong

3 0
3 years ago
Steroid hormones are __________. all of the above are correct. synthesized from cholesterol synthesized on demand and released i
sveticcg [70]
All of the above should be the correct answer
8 0
3 years ago
Other questions:
  • Which evidence originally supported Hess’s idea of seafloor spreading in 1968
    10·2 answers
  • Radiographic study of the kidneys and ureters with the use of an intravenous contrast medium.
    13·1 answer
  • Choose the best scientific design to test the question “Which soil type results in the highest yield of tomatoes: clay soil or s
    13·1 answer
  • 6. Define taxonomy? _
    7·1 answer
  • John's class has been studying blood type and donations. John is not sure what blood type he has. At dinner, John asked him mon
    14·2 answers
  • Where does transcription take place in the cell
    15·1 answer
  • This picture shows some fortified cereal in a bowl.
    9·2 answers
  • Write a 4 sentence summary of point source pollution.
    11·1 answer
  • Which of the following describes how jellyfish have a different adaptation to moving in the ocean than sharks and dolphins?
    11·1 answer
  • During replication, the genetic material of an organism has developed an error which is now part of the genome in its gamete cel
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!