1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Semenov [28]
3 years ago
15

Can some one code this dna

Biology
1 answer:
cluponka [151]3 years ago
7 0

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

You might be interested in
Cells spend the majority of their time in?
Sidana [21]
OK so the answer you are looking for is most likely going to be inter phase because that is what most cells spend their time in.
4 0
4 years ago
Hurry whoever answers first will get the brainliest
klasskru [66]
D. He has an aerator that pumps bubbles into the tank
5 0
4 years ago
Read 2 more answers
The ability of your body's immune system to distinguish between your cells
KatRina [158]

Answer:

<em>The correct option is cell surface markers.</em>

Explanation:

The immune cells of our body detect foreign particles and generate responses so that our body can get rid of them. The foreign particles are often termed as antigens.

The immune cells such as antibodies possess cell surface receptors which detect the foreign objects or antigens. When the cell surface receptors detect any antigen they immediately recognize that a foreign particle has invaded the body and they then identify it and start to generate response.

6 0
3 years ago
Ellis-van Creveld syndrome is a form of dwarfism that is inherited in an autosomal recessive pattern. This particular form of dw
jenyasd209 [6]
A) A textbook definition would be that genetic drift is: a random change in allele frequency caused by a series of chance occurences that cause an allele to become more or less common in a population. In layman's terms, this means that genetic drift happens when luck makes the genetic pool of the population to deviate from what is expected.
B) The cause for this genetic drift is the aformentioned couple. Because amish communities are small and they select partners from their community, having even a couple of carriers of alleles in a community can make the allele freuency much larger than expected; for example, if the community was 100 persons, the percentage would be in the order of 1%, still much larger than the general population. Thus, the cause here is that a small population had a couple of carriers.
C) Sexual reproduction leads to a mixing of alleles from both mother and father and helps diversity. When a population is isolated, the gene pool is fixed and no new genes can come in, reducing diversity. Also some people that have an allele might die, hitting diversity even more. Finally, having a small population creates a strong pressure in some circumstances that leads to elimination of some traits and diversity.
7 0
3 years ago
Represents the presence of the<br> rhesus protein on blood.
Roman55 [17]

AlohaS4

Answer & Explanation:

( Rh Factor ) represents the presence of the Rhesus protein in the blood.

( Rh+ ) blood contains the rhesus protein.

( Rh- ) blood does not contain the rhesus protein.

( Type O ) blood is the universal donor.

( Type AB ) blood is the universal recipient.

( Rh+ ) blood can receive Rh+ or Rh- blood.

( Rh- ) blood can receive Rh- blood.

Hope you found this helpful! <3

<em>~Aloha</em>

<em />

<em>Btw: This contains the full Edge question. So, if you're using Edge, just click "done" for each part of the question and answer it. :)</em>

6 0
3 years ago
Other questions:
  • Please help!!
    13·2 answers
  • • In what way do you think the location of the foramen magnum relates to the movement of each species? ...?
    15·2 answers
  • In addition to problems with balance and coordination, a person with damage to the cerebellum will likely have problems with ___
    9·1 answer
  • What happens to the chemical elements that make up the molecules of living things as they pass through a food web?
    9·1 answer
  • Glutamic acid and valine are two amino acids with different molecular structures. (Glutamic acid is a strongly hydrophilic molec
    15·1 answer
  • Which of the following choices gives examples of biotic factors in an ecosystem?
    7·2 answers
  • Hair would be dry and brittle without the presence of? A) sebaceous glands B) keratin C) melanin D) fat
    9·2 answers
  • A planet has a period of revolution about the Sun equal to T and a mean distance from the Sun equal to R. T2 varies directly as
    5·2 answers
  • Crystalline
    5·1 answer
  • How meiosis affects chromosome number
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!