1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Semenov [28]
4 years ago
15

Can some one code this dna

Biology
1 answer:
cluponka [151]4 years ago
7 0

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

You might be interested in
What are the functions of the pioneer community look at the pic
Zolol [24]

Answer:

D

Explanation:

7 0
3 years ago
Water mitosis and Metosis​
BARSIC [14]

Answer:

Mitosis results in two identical daughter cells, whereas meiosis results in four sex cells.

5 0
4 years ago
Explain the mistake you see in image 2
GuDViN [60]

Answer:

wordare

Explanation:

ons loin any groot

6 0
3 years ago
Importance of environment
larisa86 [58]

Answer:

The enviornment is important because its where animals interact with nature, materials, and how they live life. Messing with the environment can kill a whole species or even a whole forest. The environment is where animals make their habitat and improve their own homes. Without environments we would not be able to live because the food we need would end up dying or just moving to find another location to live. Without prey or predators, the environment in incomplete and there's a high chance we will overpopulate or just die.

5 0
3 years ago
What is the rate at which the body expends energy for daily maintenance activities, like keeping the body alive and organ functi
gavmur [86]
Basal metabolic rate
6 0
2 years ago
Other questions:
  • What is an effect of adaptive radiation apex?
    15·2 answers
  • On the challeneger scientists mission was to study organisms that live in the sea the depths of the oceans nd the
    10·1 answer
  • One traditional flood control method has been to attempt to keep the streams flow within it's channel by creating_____?
    13·2 answers
  • Contains DNA that regulates the functions of the cell
    10·1 answer
  • Signals sent from the human brain through the phrenic nerves induce synchronous spasms of the diaphragm. These spasms are common
    13·1 answer
  • Bikers racing in the tour de France must fuel their bodies each night to prepare for the next days race over the next 3 weeks. I
    12·1 answer
  • 19.
    11·2 answers
  • What evidences do scientist use to support the continental drift theory ?
    5·1 answer
  • Which of the following is a shrub ?<br> (a) Tomato (b) Mint (c) Coconut (d) Lemon
    7·2 answers
  • Name two strengthening/support tissues. Explain your answer
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!