All categories

3 years ago

Can some one code this dna

Biology

1 answer:

cluponka [151]3 years ago

7 0

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand

TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand

GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand

GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand

AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

You might be interested in

Supposed a biologist design an experiment to study the effect of water pollution on the reproduction rate f salmon.what is the d

ANTONII [103]

The dependant variable would be the salmon, because they depend on the water and pollution levels to give a result.

4 0

3 years ago

Read 2 more answers

Axons cross from one side of the spinal cord to the other through the

Airida [17]

<h2>Axons </h2>

Explanation:

Axons cross from one side of the spinal cord to the other through the gray commisure

Each arm or extension of the gray matter in the spinal cord is referred to as a horn
Projecting towards the back of the spinal cord are the dorsal horns (or posterior horns)
Projecting towards the front are the ventral horns (or anterior horns)
In the thoracic and upper lumbar regions of the cord, an additional pair of side projections occur, which are called the lateral horns
A narrow band of gray matter known as the gray commissure stretches across of the center of the spinal cord and connects the two sets of horns
In the middle of the gray commissure is the central canal, which contains cerebral spinal fluid

7 0

3 years ago

Choose a biome that was discussed during your lesson. Describe this biome including the climate that exists there. What animals

olasank [31]

Answer:what biomes ya got

Explanation:

Will determine the answer

3 0

3 years ago

Compare and contrast correlational and experimental research by designing two types of studies that aim to answer the same quest

3241004551 [841]

Answer:

Correlation means that there is a relationship between two or more variables (such as ice cream consumption and crime), but this relationship does not necessarily imply cause and effect. When two variables are correlated, it simply means that as one variable changes, so does the other. We can measure correlation by calculating a statistic known as a correlation coefficient. A correlation coefficient is a number from -1 to +1 that indicates the strength and direction of the relationship between variables. The correlation coefficient is usually represented by the letter r.

Explanation:

6 0

3 years ago

Read 2 more answers

What are some of the negative environmental effects of agriculture, and why do they occur?

Sladkaya [172]

Answer:

La producción agropecuaria tiene unos profundos efectos en el medio ambiente en conjunto. Son la principal fuente de contaminación del agua por nitratos, fosfatos y plaguicidas. ... Si se utilizan más métodos de producción sostenible, se podrán atenuar los efectos de la agricultura sobre el medio ambiente. I hope it helps you

Explanation:

3 0

3 years ago