1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Semenov [28]
3 years ago
15

Can some one code this dna

Biology
1 answer:
cluponka [151]3 years ago
7 0

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

You might be interested in
According to the image above, the four species share _______ structures which indicates that they all share a _______ ancestor.
irina [24]

Answer:

homologous, high levels of, natural selection

3 0
3 years ago
Read 2 more answers
Chemical substances that organism require to live
Arisa [49]
Oxigen ,nitrogen ,carbon,and hydrogen.
5 0
3 years ago
Which organism develops breathing organs from pharyngeal arches?
lubasha [3.4K]

Answer:

The answer is shark.

8 0
3 years ago
Read 2 more answers
Given that the tundra is very dry most of the year, why don't plants that live on the tundra have deep roots to search for water
ExtremeBDS [4]

Explanation:

plants that are shorter and need little to no soil are most efficient. Lichens, which are part fungus and usually part algae, don't need extensive root or water-transportation system

5 0
3 years ago
Explain why sponges and cnidarians were the first animals to evolve
malfutka [58]
Once the Earth was full of water (ocean) after volcanic activities the mainland became land ( sorry about my english i am hungarian and i am still learning the language )
6 0
3 years ago
Read 2 more answers
Other questions:
  • In the context of psychosomatic medicine, Flanders Dunbar and Franz Alexander maintained that conflicts produce anxiety, which b
    6·1 answer
  • Dinobryon is a species of protozoa that reproduces asexually. How is it better for the survival of the species for the protozoa
    8·2 answers
  • To transform bacteria with plasmids, technicians first make the bacteria competent (capable of taking up DNA) by placing them in
    12·1 answer
  • The structure of a cell nucleus would be seen in the greatest detail by using what
    8·1 answer
  • A group of organisms at any level in a classification system is called a:
    13·1 answer
  • If the Moon has soil similar to Earth, then the Moon may have come from Earth. Which question best matches this hypothesis?
    7·1 answer
  • Where does a fertilized egg spend most of its time?
    13·2 answers
  • !Plz help! !I keep getting different answers! Cellular respiration refers to:
    8·1 answer
  • 5 point
    13·1 answer
  • Look at the image of the solar system.The solar system shows the planets in their orbits around the Sun in this order: Mercury,
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!