1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Semenov [28]
3 years ago
15

Can some one code this dna

Biology
1 answer:
cluponka [151]3 years ago
7 0

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

You might be interested in
In what way do adaptations help the survival of a species?
mylen [45]

Answer:

B

Explanation:

Adaptation can be described as a process that helps the organisms fit their environment and enhancing their evolutionary fitness (reproductive success). Adaptation makes organism become well-suited for an environment and thus, help them to survive and produce more offspring. Also, adaptation may refer to a phenotypic or adaptive trait with a functional role in the success of each organism in their habitat.

They increase the genetic diversity of the species

3 0
3 years ago
Read 2 more answers
Which of these pairs of body structures BEST illustrates a homologous relationship?
Rashid [163]
<span>A) Leg of a horse and the leg of a dog.
The rest of the choices are examples of convergent evolution because they are similar in  structures that evolved in separate places in the animal kingdom.
>Bats are mammals and birds are not, yet they both evolved a similar appendage</span><span>
Choices to this question are:
A) the leg of a horse and the leg of a dog
B) the wing of a bat and the wing of a bird
C) the fin of a dolphin and the fin of a shark
D) the beak of a bird and the beak of a turtle</span>
4 0
3 years ago
The goal of _____ is to use cells and tissues treat human issued an injury
galina1969 [7]
Therapeutic cloning Is the answer you’re looking for
8 0
2 years ago
Read 2 more answers
if a group of _____ species lived together in a small area, the carrying capacity of that area would probably collapse quickly??
alukav5142 [94]
The answer is K-selected.

The population size of K-selected species is fairly constant in time, unlike the population size of r-selected species. r-selected species are usually bellow carrying capacity and the population size is density independent. On the contrary, K-selected species are usually near or at carrying capacity and the population size is density dependent.
7 0
3 years ago
Read 2 more answers
It does not seem particularly surprising to us that we might find gill pouches, tails, or other such structures in humans. But w
Pavel [41]

Answer:

In the course of evolution mammals are the animals which are evolved recently as compared to other groups such as fish, amphibians, or reptiles.

In addition, fur or hairs on body, mammary glands, middle ear bone, warm-blood, et cetera are the characteristics of mammals.

These characteristics were evolved during the course of evolution; they were not present in ancestral organisms.

However, tail, gill pouches, et cetera are characteristics of our ancestral groups. Thus, characters can be sometimes observed in mammals.

But mammals characteristics can not be observed in organisms which were evolved before mammals such as fishes, amphibians, reptiles, et cetera.

5 0
3 years ago
Other questions:
  • Which of the following is a group of cells that work together to preform a specific function
    10·1 answer
  • The normal upper end of the temperature reference range of a goat is 103.5 degrees fahrenheit. what would be the maximum body te
    14·2 answers
  • Some reactions that break down glucose occur in different parts of the cell than others, why?
    11·1 answer
  • What is the total of magnification if you were using a 40x objective?
    6·1 answer
  • which is important is most similar to the evidence that during used to support his idea of natural selection​
    9·1 answer
  • ●all of the members of a given species in a community
    5·1 answer
  • I need help with the questions fast
    7·1 answer
  • You want to engineer a eukaryotic gene into bacterial colony and have it expressed. What must be included in addition to the cod
    6·1 answer
  • all of the triplet codes needed to produce a specific polypeptide chain are found in a(n)____________.
    6·1 answer
  • LOOK AT THE PICTURE!!
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!