1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bogdanovich [222]
2 years ago
13

Radiographic study of the kidneys and ureters with the use of an intravenous contrast medium.

Biology
1 answer:
barxatty [35]2 years ago
4 0
For the answer to the question above, I believe the answer is
intravenous pyelogram (IVP)It is <span>an x-ray examination that uses injection of contrast material to evaluate your kidneys, ureters, and bladder and to help diagnose the blood in the urine or pain in your side or lower back.</span>
You might be interested in
Five different species of warblers, seed-eating birds, live in the same species of conifer trees. All of the birds migrate to co
sashaice [31]

Answer:

both c and d are pretty accurate, but i dont have very much knowledge on warblers specifically. but those 2 answers would be the most common for such a case

Explanation:

5 0
3 years ago
Molecule broken down as a source of energy
Y_Kistochka [10]
Most likely ATP next time put the answer choices in for multiple choice questions.
8 0
3 years ago
Fruit flies have 8 chromosomes in their body cells, while dandelion cells have 16 chromosomes. Which species do you predict make
Finger [1]

Answer:

I think this might be the answer

Explanation: The answer is the same for every diploid species. It is half the number of chromosomes in somatic (body) cells. The number of cells in gametes (sex cells) is n and the number in somatic cells is 2n. For fruit flies gametes have 4 chromosomes, for mice, 20, for humans 23, for chimpanzees 24.

Hope this helps and stay safe.

4 0
3 years ago
Some organizations reduce the carbon waste on earth by purchasing ______________ equivalent to their carbon footprint.
pychu [463]
Cap and Trade is the equivelent to carbon footprint
8 0
3 years ago
How do the size of each population affect each other
enyata [817]

Answer:

economic and everything

Explanation:

If one population dies out, all the populations that depend on that species for food may also die out. A change in one population affects the entire community because all the populations of a community depend on each other. ... A population is all the members of one type of organism living in an ecosystem.

As a population grows in an area, a population may experience the effects of increased densities. In a given area, is the maximum population size of the species that the environment can sustain is called the carrying capacity. Carrying capacity is determined by the amount of available resources (food, habitat, water).

4 0
3 years ago
Other questions:
  • Which part of the respiratory system is composed of skeletal muscle?
    6·1 answer
  • Refers to the type of microscope Leeuwenhoek made with one lens...
    13·1 answer
  • In a species of snail, dark-shelled individuals are better hidden from bird predators in the shady forest, while light-shelled i
    13·1 answer
  • Tay-sachs is a recessive genetic disease in humans. both parents are carriers (heterozygous), what are the chances that their ch
    14·1 answer
  • I need help with my biology​
    6·1 answer
  • NEED ANSWER FAST!!!!
    10·1 answer
  • 7. Explain why protein is an important part of a person's diet. (remember the important functions of proteins).​
    13·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • At which approximate light intensity does the oxygen production begin to level oft?
    9·1 answer
  • Which level of classification contains all the others?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!