Answer:
This type of brain plasticity is known as neuroplasticity.
Explanation:
Neuroplasticity allows neurons to regenerate (anatomically and functionally), which allows them to form synaptic connections. Neural plasticity means the ability of the brain to recover and restructure. This is a characteristic of the adaptive potential of the nervous system allowing the brain to recover from disorders, and can also reduce the negative effects of diseases such as multiple sclerosis, Parkinson's, Alzheimer's disease, etc.
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
That would be CO2 also known as carbon dioxide.
The answer is B.
It warms and filters the air as it enters the sinus, it also retains moisture because cold dry air could irritate the lungs.
