1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nekit [7.7K]
3 years ago
13

PLS HELP ASAP WILL GIVE BRAINLIEST !!!

Biology
2 answers:
andre [41]3 years ago
7 0

Answer:

The overall three-dimensional structure of a polypeptide is called its tertiary structure. The tertiary structure is primarily due to interactions between the R groups of the amino acids that make up the protein. ... These include hydrophobic interactions, ionic bonds, hydrogen bonds, and disulfide bridge formation.

dem82 [27]3 years ago
4 0
All proteins are made up of a sequence of amino acids in a polypeptide chain. The simplest answer, of course, would be amino acids.

I hope I helped!
You might be interested in
The Venn diagram details some of the helpful and harmful effects of bacteria. In what ways are viruses like bacteria?
dimaraw [331]

Answer:

A) Viruses are also pathogenic

Explanation:

A pathogen<u> is an organism that is capable of causing a disease to another organism.</u> Viruses, similarly to bacteria, are able to cause a diversity of diseases. However, they are considered non-living organisms because they fully depend on another cell to survive and reproduce. Therefore, they can only cause an infection if the organism's cells can support the replication of the virus. Moreover, to cause disease, the infecting virus has to overcome numerous "challenges", from  physical barriers to host defenses.

Viruses can cause the following diseases:

  • Common cold
  • Influenza
  • Herpes
  • HIV
  • Ebola
  • Smallpox
  • Rabies

amongst many others...

5 0
4 years ago
Read 2 more answers
(c) Fig. 4.2 shows the rate of water conduction up three different trees in a forest over 24 hours.
vovangra [49]

Answer:

conduction up three different trees in a forest over 24 hours.

2.5

4 0
3 years ago
Anyone know the answer???
KATRIN_1 [288]

Answer:

what is the question

Explanation:

I does not know wnser

6 0
3 years ago
What three molecules are produced by cellular respiration?
Anna007 [38]

Carbon dioxide, Water (sweat), and Energy in the form of ATP.

8 0
4 years ago
What is the independent variable in this experiment? A) temperature B) Number of chirps C) Number of crickets D) Location of the
ale4655 [162]
I don't know what the expieraments about but I can say its rather B or C the independent variable is the variable that you are testing.
8 0
4 years ago
Other questions:
  • Imagine that you are studying a very large population of moths that is isolated from gene flow. A single gene controls wing colo
    14·1 answer
  • 2. Living things can weather and erode the Earth. Which statement is true?
    9·2 answers
  • How did Aristote classify organisms
    9·1 answer
  • Non-constituitive system with visible light energy breaking covalent T-T bonds Multiple enzymes may repair an A-C error left unr
    8·1 answer
  • The nebular model explains
    9·2 answers
  • What does Milky Way look like from earth
    15·2 answers
  • What is the second box​
    14·1 answer
  • Which of the following best describes a limiting factor of renewable energy?
    15·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • More hlep ..................................................................................
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!