6. A cell is 20 micrometers across. What type of cell is this? A. Plantae B. Prokaryotic C. Animalia D. Eukaryotic

Biology

2 answers:

weqwewe [10]3 years ago

8 0

Answer:

Explanation:

Eukaryotic cells are usually bigger than prokaryotic cells. Generally, prokaryotes cels size will range between 1 and 10 micrometers while that of eukaryotes will range between 10 – 30 micrometers. Due to the small cell size of prokaryotes, elements can diffuse in and out of the whole cell. However, for eukaryotes, cellular mechanism need to assist the distribution (in and out) of elements in the cell.

mylen [45]3 years ago

5 0

Answer:

D. Eukaryotic

Explanation:

You might be interested in

Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i

Marat540 [252]

During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.

In this case, the complementary mRNA sequence is:

3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´

Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.

Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.

According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.

In RNA, Thymine (T) bases are replaced by Uracil (U).

Learn more in:

brainly.com/question/837295?referrer=searchResults

7 0

3 years ago

Why do vertebrates have vertebrae instead of just having one long backbone?

Anarel [89]

Answer:

so we can move our back and be flexible

Explanation:

brainliest?

6 0

2 years ago

Adaptive radiation occurs when a population colonize a new environment that has a variety of different habits and FEIL competito

CaHeK987 [17]

Answer:

True (although question is not clear enough)

Explanation:

Adaptive radiation occurs when organisms evolve from the same ancestor. This process takes place as a result of environmental changes or when they are introduced to or colonize a new environment. These changes become challenges that force these individuals to adapt to these new conditions.

Therefore, this results into a faster evolution that creates different new forms that possess a diversity of variations adapted to their new feeding habits, environment, and behavioral needs.

One of the most famous examples of adaptive radiation is the formation of new forms of Galapagos finches. These striking finches, which arose from a common ancestor, evolved different beak sizes and shapes that were especially adapted to different types of food. As different as they may appear, they are closely related!