1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zalisa [80]
3 years ago
5

The phospholipid bilayer also contains ____ which links the fatty acids together.

Biology
1 answer:
GalinKa [24]3 years ago
4 0
Cholesterol, I believe is the answer.
You might be interested in
Why do skin cells grow back when skin cells get damaged
ale4655 [162]

Answer: The ability of the skin to heal even after considerable damage has occurred is due to the presence of stem cells in the dermis and cells in the stratum basale of the epidermis, all of which can generate new tissue. ... These active cells produce collagenous fibers and ground substance. Hope this helps can u give me brainliest

Explanation:

5 0
3 years ago
With the widespread public interest in low-fat food, some companies have started to use synthetic fats that cannot be broken dow
hjlf

Answer:

the answerd is  AAAAAAAAAA

Explanation:

8 0
4 years ago
PLEASE HELP ON LAST 3 40 POINTS
Vika [28.1K]
<h2>Answer</h2>

Where low tide occurs?

Low tides occur between two high tide areas. They form 90 degree angles with the moon.

Where high tide occurs?

Parts of the earth when facing the moon, those parts experience the pull force, cause high tides. They occur in the areas closest to and farthest from the moon.

How often high tide occurs?

Hide tides occur twice a day. Coastal areas experience high tides every 12 hours.


3 0
3 years ago
A normal plant cell holds water in the vacuole of the cell. This large organelle also gives the cell support. Suppose a plant is
Aneli [31]
Explain that water moves down a water potential gradient, and the salt solution has a lower water potential than the vacuole so water leaves the vacuole through osmosis

In exam Q's key points are:
- Water potential gradient
- Higher water potential in vacuole
- Leaves through osmosis
6 0
3 years ago
Read 2 more answers
How might dr. Mombutubwa recognize and successfully diagnose Ebola in his patients?
allsm [11]
It generally complained of flu-like symptoms (headache, fever, muscle pain, sore throat) followed closely by stomach pain, vomiting, and diarrhea, which sometimes progressed to the bruising and hemorrhaging that he was seeing in his current patient.
3 0
4 years ago
Other questions:
  • My homework says chicken has more protein carrots, what dors that mean?
    7·2 answers
  • In the United States, the parasite that causes malaria is not present, but it is present in African-Americans whose ancestors we
    10·1 answer
  • Which statement best describes what happened when Constantine tried to establish "New Rome"?
    5·1 answer
  • A population crisis usually occurs in a country that has:
    7·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Name the plantation dance that started out as an improvisation of stomping and shuffling steps and developed into fancy sliding
    7·1 answer
  • How many plants are in the solar system
    11·2 answers
  • What happens to water when it boils​
    7·1 answer
  • The energy that a plant needs to grow is
    11·1 answer
  • Select the correct answer from each drop-down menu. The carbon cycle can interact with the water cycle. For example, when people
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!