1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inysia [295]
4 years ago
9

How are pathogens able to get past the body’s first line of defence?

Biology
1 answer:
Klio2033 [76]4 years ago
8 0

Answer:

Stomach acid kills bacteria and parasites that have been swallowed. Your urine flow flushes out pathogens from the bladder area. Skin, tears and mucus are part of the first line of defence in fighting infection. They help to protect us against invading pathogens

Explanation:

You might be interested in
Genotype describes the specific genetic characteristics of a living thing and cannot be __________________. Phenotype describes
Gnom [1K]

Answer:

that cannot be changed because of it dominancy

5 0
3 years ago
Heterotrophs select one:
Talja [164]
B is the only answer that correctly correlates to the question. Heterotrophs are organism that are not able to produce their own source of food. To acquire food, they depend on the organic molecules produced by producers.
8 0
3 years ago
I need help with this question- I put one answer but need to find the other
ale4655 [162]

Answer:

Proton and Energy

Explanation:

Your answer you choose is correct, you can cross out magma because that connects with lava not, nuclear functions, and vapor, since that connects with the water cycle.

Hopefully, it helps! (づ。◕‿‿◕。)づ

3 0
3 years ago
Wurtz, Goldberg, and Robinson showed that the firing rates of neurons in the parietal cortex are enhanced when an animal subsequ
Iteru [2.4K]

Answer:

The increased activity prior to the saccade reflects a shift in attention to the stimulus inside that neuron's receptive field.

Explanation:

They observed that the neurological basis of attention, first made in the superior colliculus has been extended to a number of areas in both the dorsal and ventral streams.

6 0
3 years ago
Only about ______ of water is fresh and suitable for human use.
Anastaziya [24]
<span>Only about 75% of water is fresh and suitable for human use.

Hope I helped ^_^

Please hit dat "THANKS" button!</span>
5 0
3 years ago
Other questions:
  • A group of paleontologists are examining the fossils of a dinosaur in Asia. They find that fossils of certain transition stages
    10·1 answer
  • What role are hurricanes suspected to play in Earth’s climate?
    11·1 answer
  • 1. Why must DNA have thymine instead of Uracil? 2. Why is it necessary for RNA to have uracil instead of thymine?
    8·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which Mimulus species would you categorize as mainly asexual reproducers? Why? A. M. rupestris and M. eastwoodiae; they put more
    11·1 answer
  • What is one way a plain can form
    14·2 answers
  • Both plants and animals have these organelles to store and pass on genetic information
    10·1 answer
  • Some wetlands have high salinity. Does that restrict the number of species that live there?
    9·1 answer
  • Explain the characteristics scientists use when
    8·1 answer
  • Why was water used to dilute the substances instead of another chemical?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!