1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nezavi [6.7K]
3 years ago
10

What is the relation between structure and function

Biology
1 answer:
kolezko [41]3 years ago
6 0
Structure refers to the body
function refers to how the body works.
You might be interested in
A)<br> Suggest why mitochondrial diseases in humans can<br> cause symptoms such as muscle weakness.
RoseWind [281]

Answer:

How it can cause muscle weakness

Explanation:

Mitochondrial myopathies are a group of neuromuscular diseases caused by damage to the mitochondria—small, energy-producing structures that serve as the cells' "power plants." Nerve cells in the brain and muscles require a great deal of energy and thus appear to be particularly damaged when mitochondrial dysfunction

6 0
2 years ago
Select the correct Image.
g100num [7]

Answer:

Image 2

Explanation:

It's where the cells begin dividing

8 0
4 years ago
Read 2 more answers
You never have to worry about wastewater becoming contaminated because it can run through local treatment plants, true or false?
ddd [48]
Water does go threw water treatments to treat water so I’ll say true
3 0
4 years ago
The United States Weather Bureau issued hurricane warnings before Hurricane Betsy moved over land areas. state two actions that
Margarita [4]
The Unite States Weather Bureau advised the small crafts of Leeward and Windward to remain in the port until the hurricane passed. Hurricane watching and gale warnings were also issued. People were advised to stay in their houses and collect grocery for themselves. 
7 0
4 years ago
Charles darwin's on the origin of species has its strongest influence on the school of thought called
riadik2000 [5.3K]
Functionalism. It is according to the concept 'survival of the fittest'
4 0
4 years ago
Other questions:
  • Explain how temperature can bring about changes<br> in the state of matter.
    8·2 answers
  • What is the difference between a tissue and an organ system? an organ system includes tissues. tissues are composed of organ sys
    10·1 answer
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • Can someone please write 2 paragraphs about how the world would be affected if we didn’t have season change ?
    6·1 answer
  • Witch of the following accord along coasts during the day
    8·1 answer
  • Could NaCi dissolve in water ?
    5·2 answers
  • Chlamydia infection is the leading cause of _______________ in men under age 35.
    15·1 answer
  • The difference beetween functional and non functional
    15·1 answer
  • HELPPPPPPPPPPPPP!!!
    15·2 answers
  • Please select the word from the list that best fits the definition
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!