1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nikdorinn [45]
3 years ago
12

Help please ❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️

Biology
1 answer:
erastovalidia [21]3 years ago
8 0

Answer:

Explanation:more details please

You might be interested in
What is the name of the tiny air sacs in your lungs?
yKpoI14uk [10]

Answer:

alveoli please leave brainliest

7 0
3 years ago
Read 2 more answers
which cell structure is mainly responsible for releasing energy for food melecules in some single cell organisms?
yanalaym [24]
Mitochondrion, I think.
3 0
3 years ago
The part of an enzyme molecule where a substrate molecule attaches
netineya [11]
This part of the enzyme is known as the active site. Enzymes are organic molecules that catalyze certain chemical reactions in the body. A catalyst is any chemical that speeds up another reaction without being used up in the reaction itself. This means that at the end of the reaction the enzyme is able to operate on other molecules in another reaction.
7 0
3 years ago
What will the overall charge of an atom be if it has more protons than electrons?
sineoko [7]

Answer:

D

Explanation:

A: Neutrally charged atoms have the same number of protons and electrons.

B: Negatively charged atoms have more electrons than protons. These are also called anions.

C: ironically charged is a molecule that has a charge so a cation or an anion. This option isn't correct becuase it's not specific enough for the question. An ion can be positively charged (cation) or negatively charged (anion).

5 0
2 years ago
Creating a prototype and troubleshooting are steps in the development of
EastWind [94]
I think .....it is A???
8 0
3 years ago
Read 2 more answers
Other questions:
  • In the diagram of a boiling water nuclear fission reactor, steam turns a turbine, which powers a generator to create electricity
    6·2 answers
  • In a car accident, a person sustained major trauma to his brain and the spinal cord region of his neck. damage, in this case, wa
    15·1 answer
  • Arrange the cells in order from least specialized to most specialized. Cells of the mesoderm cells of a zygote cells of a blasto
    9·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • True or False?
    13·1 answer
  • In 2006, the United States government created the largest marine wildlife preserve in the world. The preserve is located around
    14·1 answer
  • which property has not been observed for membrane proteins being degraded for energy during biological pathways
    12·1 answer
  • When will a seed begin to germinate?
    7·1 answer
  • What term refers to the functions of an organism
    10·1 answer
  • Which of the following is the best example of a population?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!