1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
german
2 years ago
5

This is my question cellular respiration

Biology
1 answer:
lyudmila [28]2 years ago
8 0
Carbon dioxide, NADH and ATP
You might be interested in
Organisms that use the sun energy to turn water and carbon dioxide into food molecules are called
s344n2d4d5 [400]
Producers.... hope this helps :)
5 0
2 years ago
The reaction between allergens and ige antibodies causes the release of chemical substances such as __________.
Levart [38]
The reaction between allergens and IgE antibodies causes the release of chemical substances such as

histamine, leukotrienes and prostaglandins

<span>
</span>
7 0
3 years ago
If element X has 15 protons, how many electrons does it have?
gtnhenbr [62]
If element X has 15 protons, it would also have 15 electrons.
8 0
3 years ago
Read 2 more answers
Hakeem is testing the effects of sunlight on samples of soil. Which of these actions would introduce confounding variables into
satela [25.4K]

A confounding variable refers to an external effect, which modifies the influence of an independent and dependent variable. This extraneous effect is used to affect the outcome of an experimental design. The confounding variables can ruin the experiment and can generate unnecessary outcomes.  

In the given case, confounding variables can be introduced by testing multiple hypotheses at a time and by using distinct kinds of soil in each of the samples.  


7 0
3 years ago
Read 2 more answers
What are some events that happen during the first part of the pregnancy ? Please answer this !!
Ostrovityanka [42]
Symptoms include feeling tired feeling bloated peeing more than usual mood swings nausea and tender or swollen breasts
4 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What is a function of the intestinal microvilli? nutrition?
    12·1 answer
  • After a spermatozoon unites with an ovum, the resulting cell with 46 chromosomes is known as a/an ________. embryo gamete fetus
    11·1 answer
  • The structure of the spinal cord can be described as (1) composed of thirty-one segments (2) having a cervical enlargement, lumb
    11·1 answer
  • What is one main reason we need water?
    5·1 answer
  • What factors might increase or decrease the probability of a species going extinct?
    11·1 answer
  • What plant organelles can the plant cell not survive without?
    7·1 answer
  • When there are unbonded ends of the DNA, they are called
    5·2 answers
  • A six carbon sugar is an example of a
    15·1 answer
  • Solar power plants that use a central receiver system or a distributed receiver
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!