1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amm1812
3 years ago
12

Why are data tables useful in an experiment?

Biology
2 answers:
N76 [4]3 years ago
8 0
C. Because data tables are good for keeping good track of your data and can make looking back on it and gathering evidence much easier
vladimir2022 [97]3 years ago
4 0

Answer: C

Explanation:

they help keep good records of measurements and observations and gives an easier interpretation of data

You might be interested in
Please help I’m being timed and please no links
vlada-n [284]
I would think A I’m not sure
4 0
3 years ago
Read 2 more answers
AUUUAACUGUUCUGUCUAGAG
Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0
3 years ago
The group of processes that transform sediments into rock is known as _____.
irina1246 [14]
It is known as lithification
3 0
4 years ago
PLEASE HELP !!<br> ILL GIVE BRAINLIEST <br><br> NO LINKS OR FILES.
zzz [600]

Answer:

The answer is C.

4 0
3 years ago
Auricular myiasis refers to fly larvae in the __________ tissue.
Nikolay [14]
Auricular Myiasis  refers  to fly  larvae  in  the  ear  tissue. Myiasis is  the inversion  of  body  tissue  of  animal by  the  larvae  of diptera  or two winged flies. Myiasis  parasitic infection  by the fly  larvae inside  the   while feeding  on  the  tissue. 
8 0
3 years ago
Other questions:
  • Galaxy that has a dense core of stars and has spiral arms
    9·1 answer
  • What is causing the bee population to decline?
    11·1 answer
  • Why is adaption most likely to help a cactus survive and dry climate
    8·1 answer
  • Which of the following best defines iconoclast?
    7·2 answers
  • The fundamental resolution of an optical instrument is set by
    6·2 answers
  • Which factor is linked to a decrease in the incidents of SIDS in the United States?
    15·1 answer
  • All of the following are classified as seedless vascular plants except
    14·1 answer
  • What is the main function of the nuclear membrane?
    14·1 answer
  • As heat
    9·1 answer
  • A substance taken into the body by ingestion, inhalation, injection, or absorption that interferes with normal physiological fun
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!