1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sauron [17]
4 years ago
7

Select all that apply.

Biology
2 answers:
shtirl [24]4 years ago
8 0

Answer:

All the given options except selective breeding are the methods of molecular biotechnology.

Molecular biotechnology refers to the study and modification of proteins and nucleic acids with the help of laboratory techniques.

It creates many applications in the field of medicine, agriculture, animal health, and the environment.

It mainly involves the modification and introduction of a foreign gene into an organism in order to produce desirable products.

Thus, recombinant DNA, molecular hybridization, cloning, induced mutation, DNA profiling all come under this steam.

In contrast, elective breeding is not an example of molecular biotechnology as it does not include modification at molecular level. It is a method used in used in genetics in order to produce offspring with desired character.

ryzh [129]4 years ago
5 0
Molecular biotechnology is basically the study and alteration of nucleic acids and proteins in living organisms for various applications. It encompasses the different scientific fields of genetics, engineering, chemistry, microbiology, etc. Because of this, all of the given choices are methods of molecular biotechnology EXCEPT DNA profiling.
You might be interested in
The genes that masks the effects of other genes
kicyunya [14]

epistatic gene

Explanation:

Some genes mask the expression of other genes just as a fully dominant allele masks the expression of its recessive counterpart. A gene that masks the phenotypic effect of another gene is called an epistatic gene; the gene it subordinates is the hypostatic gene.

7 0
3 years ago
Explain how humans react and adapt to the limited availability of water<br> NEED ASAP
miss Akunina [59]

Answer:

One of the easiest things people can do when water is scarce is limit its use. for example take shorter showers, water your lawns less

Explanation:

4 0
3 years ago
Read 2 more answers
Do new trees provide the same resources for animals in the forest as adult trees do?
Thepotemich [5.8K]

Answer:

Yes

Explanation:

No matter what age, trees still give out oxygen. It may not be the same amount as an older tree, but it still has the same effect.

3 0
3 years ago
Carrying a jute bag for shopping <br> (a)Reduce (b) Reuse (c) Recycle
yan [13]
That's reduce. Your reusable bag decreased the amount of paper and/or plastic wasted.
8 0
3 years ago
List the 8 characteristics
lianna [129]

Answer:

8 chareristic of what? of life?  cellular organization, reproduction, metabolism, homeostasis, heredity, response to stimuli, growth and development, and adaptation through evolution.

3 0
3 years ago
Read 2 more answers
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Which cells are produced during the first few divisions of the zygote?
    9·1 answer
  • If there was a chain of seven amino acids, how many possibilities are there for different proteins?
    7·1 answer
  • Which statement about scientific theories is true?
    12·2 answers
  • Which of the following choices best describes dopamine?
    10·1 answer
  • Marge Simpson decided to start a new garden in her backyard. She heard that plants compete for space and decided to test this id
    6·2 answers
  • Why in sudden outbreaks, it may be better to test for disease antigens rather than for antibodies?
    10·2 answers
  • How has erosion affected the appearance of appalachian mountains?
    11·1 answer
  • When the insulin molecule is folded where do you find leucine and isoleucine? Where do you find arginine and glutamate?
    15·1 answer
  • What is Geographic isolation? *
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!