1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RSB [31]
3 years ago
11

What do the empty shapes in a pedigree chart mean? a)Unaffected/Carrier b0Affected

Biology
1 answer:
kozerog [31]3 years ago
6 0

Uhh normally they mean that the person is unaffected or a carrier, but you'd have to look at a specific one since some have different keys.

You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
Hitchhiker's thumb (H) is dominant to no hitchhiker's thumb (h). A woman who does not have hitchhiker's thumb marries a man who
Papessa [141]

Answer:

I'm assuming that the woman could have Hh or HH since they don't specify

If the woman has HH, all the children will not have a hitchhiker's thumb

if the woman has Hh the offspring could have either Hh, Hh, or hh

pls make me brainliest :) thx

5 0
3 years ago
I need help please . I can’t figure out how to do this
Andre45 [30]

Answer:

You write what you think is going to happen based off those questions. For example, on a, you could put something such as "If I eat 1 lbs of candy I will gain __ pounds." You can change the sentence around to make it your preference.

8 0
3 years ago
10. Social institutions are _ of the socialization process???. a. agents b. targets c. casualties d. opponents​
zlopas [31]

Answer:

A) Agents

Hope that helped! I wasn't 100% sure but I hope this is right. If it's wrong, please tell me! Have a good day!

4 0
2 years ago
How many atoms can a Carbon atom share?<br>A. One<br>B. Two<br>C. Three<br>D. Four<br>1<br>-​
Natasha2012 [34]

Answer:

D.4

Explanation:

It contains a carbon atom that bonds to six other atoms instead of the four we have been told carbon is limited to. Atoms form molecules by sharing electrons. Carbon has four electrons that it can share with other atoms

7 0
2 years ago
Other questions:
  • Sperm cells require approximately _______ to mature before they are ready for ejaculation.
    7·1 answer
  • During the winter months, water on the surface of a pond will typically freeze and this ice acts as an insulator for the water b
    12·2 answers
  • If a product is recycled, is anything lost in terms of material or energy?
    7·2 answers
  • When males reach a certain age, the body begins the process of puberty. how does the body control this process?
    12·2 answers
  • Which scenario is an example of a negative feedback loop?
    10·2 answers
  • In the oceans the colder water sinks into deep basins, while warmer water stays closer to the surface. The water then moves arou
    5·2 answers
  • What is the purpose of the body mass index?
    11·2 answers
  • Pioneer species are species which colonize previously uncolonized land, usually leading to ecological succession. They are the f
    9·1 answer
  • What animals eye is this?
    14·1 answer
  • Which organisms are both heterotrophic and autotrophic
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!