1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sloan [31]
4 years ago
5

What is necrosis and giver examples

Biology
1 answer:
Sergeu [11.5K]4 years ago
6 0

Answer: Necrosis is a premature death of living cells and tissues in the body.

Types : Fibrinoid necrosis, Coagulative necrosis, fat Necrosis, Liquefactive necrosis

You might be interested in
Describe the movement in the amoeba
Oliga [24]
Amoebae move by growing an extension of their bodies in the direction of movement and then flowing into it. This extension is called a pseudopod because when it's fully extended it resembles a limb, despite being only an extension of the amoeba's plasma membrane.
5 0
3 years ago
Third, SNP array is considered as low to moderate costs of per sample, despite the significant decrease in costs associated with
Alenkasestr [34]

Development and Applications of a High Throughput Genotyping Tool for Polyploid Crops: Single Nucleotide Polymorphism (SNP) Array.

Polypoid species play significant roles in agriculture and food production. Many crop species are polyploid, such as potato, wheat, strawberry, and sugarcane.

Genotyping has been a daunting task for genetic studies of polyploid crops, which lags far behind the diploid crop species.

Single nucleotide polymorphism (SNP) array is considered to be one of, high-throughput, relatively cost-efficient and automated genotyping approaches.

However, there are significant challenges for SNP identification in complex, polyploid genomes, which has seriously slowed SNP discovery and array development in polyploid species.

Ploidy is a significant factor impacting SNP qualities and validation rates of SNP markers in SNP arrays, which has been proven to be a very important tool for genetic studies and molecular breeding.

This review presents a complete overview of SNP array development and applications in polypoid crops, which will benefit the research in molecular breeding and genetics of crops with complex genomes.

To learn more about Single Nucleotide Polymorphism: brainly.com/question/7882029

#SPJ4

3 0
2 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
If a pea plant has a genotype SSTt, what are the possible genetic combinations that could be present in a single grain of pollen
lions [1.4K]
Pollen is a gamete therefore it contains half genetic information of a regular cell. all the possible combination types are S1T, S2T, S1t and S2t
8 0
4 years ago
Read 2 more answers
Which process is the first step of making a protein from DNA instructions?
-BARSIC- [3]

The first step of protein synthesis is called transcription. The DNA transcription to mRNA is actually the first step of the protein synthesis. During the transcription step the instructions encoded in the DNA of the genes are transcribed into the nucleotide sequence code of a ribonucleic acid (RNA)....

so your answer is Option (A)


4 0
4 years ago
Other questions:
  • Guys please help with the questions
    5·2 answers
  • What is the process by which cells release energy in the absences of energy?
    6·1 answer
  • Peptic ulcers are sores in the lining of the stomach that are caused by a bacterial infection. These bacteria increase the acid
    7·2 answers
  • The red bluebird controls its feather color with a single allele they can be blue (dominant) or red (recessive). What are the ge
    13·1 answer
  • atmospheric pressure begins to fall slowly during the afternoon on a clear summer day. the pressure continues to drop overnight.
    10·1 answer
  • In pasteur's investigation, how did he make his test fair?
    9·1 answer
  • Which statement describes potassium-argon dating?
    12·2 answers
  • Latency refers to ;the process of viral replication inside a host. the process of making a viral envelope from portions of the h
    11·1 answer
  • 12. Which of the following information is given to participants in clinical trials as part of obtaining informed consent?
    5·1 answer
  • Vegetable oils, such as corn oil, belong to which general class of organic substances?.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!