1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NemiM [27]
3 years ago
12

घनत्व र सापेक्षिक घनत्व बीच फरक छुट्याउ​

Biology
1 answer:
katovenus [111]3 years ago
7 0

English: Density is MassUnit Volume; relative density is the density compared to a reference substance (usually water) under standard conditions.

Nepali: घनत्व मास एकाई भोल्यूम हो; सापेक्ष घनत्व मानक अवस्था अन्तर्गत सन्दर्भ पदार्थ (सामान्यतया पानी) को तुलनामा घनत्व हो।

You might be interested in
Describe the role glaciers play in both weathering and erosion.
telo118 [61]
While moving in between areas of land glaciers erode the land around them, this eroded land leads to weathering from the sand and rocks eroded. Example The Grand Canyon 
3 0
3 years ago
The __________ are primarily responsible for maintaining the salinity of the renal medulla versus the renal cortex.
Yuki888 [10]
I forgot and have the same problem
5 0
3 years ago
Unidirectional flow in the heart is ensured because the heart contains ___________.
jekas [21]
<span>Unidirectional flow in the heart is ensured because the heart contains valves that prevent backflow.

These valves keep the flow of the heart going in one direction (hence the name "unidirectional").</span>
3 0
3 years ago
Which of the following is the term for an abnormally low white blood cell count?
Nikolay [14]

Answer:

The correct answer is- Leukopenia

Explanation:

White blood cells are present in our blood which protect our body from foreign antigens like bacteria, viruses, etc. When these white blood cells decrease abnormally in number then this condition is called leukopenia.

White blood cells contain different cell which protect our body from different type of infections. So there are different types of leukopenia according to the particular white blood cell whose number became low.

For example when neutrophils number in the body decrease it is called neutropenia. So the correct answer is leukopenia.

4 0
3 years ago
The nurse is assessing a 15-year-old high school student who is worried because she has not yet begun menses. the nurse tells th
KatRina [158]

The nurse have noted that the patient might have anorexia nervosa due to low body mass index, due to malnutrition a delayed onset of menstruation may result. Anorexia is an eating disorder characterized by low weight and a strong desire to be thin. Another assessment finding is that the patient might have type 1 diabetes mellitus where there is a risk of developing amenorrhea caused by interruption in the hypothalamic-pituitary-ovarian-uterine axis.

 

4 0
3 years ago
Read 2 more answers
Other questions:
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Which of the following are physical characteristics of blood?
    10·1 answer
  • does the following statement describe a function of dna, a function of rna, a function of both rna and dna, or either dna or rna
    7·1 answer
  • Which of the following depends on reproductive structures being compatible between partners in breeding
    15·1 answer
  • Which biome has the least precipitation?
    11·1 answer
  • a student does an experiment for a science fair to study whether temperature affects the timing of crickets chirpthe student kee
    11·1 answer
  • Taylor uses a globe as a model to explain why we have day and night on Earth.
    13·1 answer
  • Please help help <br> its science
    6·1 answer
  • The contractile organelle of skeletal muscle fibers is
    6·1 answer
  • Please help! Will give brainliest if it’s the correct answer
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!