1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MrRa [10]
3 years ago
14

2. Today, scientists propose that Earth is covered with tectonic​

Biology
2 answers:
const2013 [10]3 years ago
7 0

Answer:

Plates?

Explanation:

Tectonic Plates are about the only kind of plates I've heard of, besides ones you eat off of. If you are trying to fill in the blank, "plates" should be your best answer.

Ganezh [65]3 years ago
4 0

Answer: Plates

Explanation:

Tectonic plates are the only plates that cover the underside of the Earth. If it isn't this, then scientists must have discovered something new! Hope this helped.

You might be interested in
True or False. In the first stage of urine formation, needed materials and oxygen are removed from the blood.
andre [41]
False we need to keep them
3 0
4 years ago
Help I'm confused!
aev [14]

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

7 0
3 years ago
Explain how both the digestive system and the urinary system work to conserve water in the human body.
Ghella [55]
Everything that we eat and drink contains some percentage of water. So, to start, you have to know that the human body has receptors which estimate if we have enough water in our blood and cells in general. From these receptors, the information travels through the neurons to the part of the brain that is responsible for activation of different responses. 

The digestive system is important because in its lower parts, liquids are absorbed and inserted in the bloodstream. Then through the bloodstream, they travel to all parts of the body and are absorbed by cells as needed. When blood passes through the body, it gets to the kidneys where water and electrolytes are filtered, reabsorbed if needed and excreted through the urine. 

Now, if the brain has a signal that the body has a lack of liquids, it activates hormones which influence the bloodstream in both the digestive and the urinary system. In this case, the digestive system will absorb more liquids from food because the hormones will make the blood vessels in the digestive area larger, and on the other hand, we will produce less urine because the kidneys will get an assignment from the brain to filter liquids, but to reabsorb them again as much as possible. 
3 0
3 years ago
Read 2 more answers
If a man is homozygous dominant for bend fifth finger and a woman is homozygous recessive what’s the probability that the offspr
amm1812
100% as all the offsprings will be heterozygous dominant.
8 0
3 years ago
Read 2 more answers
What is an accretionary wedge briefly describe its formation?
tatiyna
Accretionary wedge is formed when sediments accreted to the non subducting tectonic plate at a convergent plate boundary. Materials in the accretionary wedge are usually marine sediments that are scrapped off from the down going slabs of oceanic crust. Elevated regions within the ocean basin are transported towards the subduction zones and accreted to the continental margin.
3 0
4 years ago
Other questions:
  • What is the probability of heterozygous offspring between this cross: Ggrr x ggRR?
    6·1 answer
  • Which is not true of skeletal muscle? which is not true of skeletal muscle? it influences the body's contours and shape. it is o
    15·1 answer
  • Cystic fibrosis is a hereditary disorder caused by a recessive mutation. in a previous marriage, jim had a child with cystic fib
    5·2 answers
  • Chromosome 11 is made over _ million base pairs
    7·2 answers
  • Friction between a skateboard wheel and the surface produces             ?
    13·1 answer
  • Which of the following diseases occurs when an infected female mosquito bites a dog and the larvae migrate through the tissues a
    15·1 answer
  • The tight coiling and looping of the glomerular capillaries is functionally important, because it:
    13·1 answer
  • What is a possible effect of an error during transaction?
    13·1 answer
  • The effects of acid deposition include all of the following except . . .A) Mobilization of metal ions from the soil into surface
    10·1 answer
  • What is an insoluble component of plasma that forms a meshwork of strands and is considered the structural basis of clot formati
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!