Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
Everything that we eat and drink contains some percentage of water. So, to start, you have to know that the human body has receptors which estimate if we have enough water in our blood and cells in general. From these receptors, the information travels through the neurons to the part of the brain that is responsible for activation of different responses.
The digestive system is important because in its lower parts, liquids are absorbed and inserted in the bloodstream. Then through the bloodstream, they travel to all parts of the body and are absorbed by cells as needed. When blood passes through the body, it gets to the kidneys where water and electrolytes are filtered, reabsorbed if needed and excreted through the urine.
Now, if the brain has a signal that the body has a lack of liquids, it activates hormones which influence the bloodstream in both the digestive and the urinary system. In this case, the digestive system will absorb more liquids from food because the hormones will make the blood vessels in the digestive area larger, and on the other hand, we will produce less urine because the kidneys will get an assignment from the brain to filter liquids, but to reabsorb them again as much as possible.
100% as all the offsprings will be heterozygous dominant.
Accretionary wedge is formed when sediments accreted to the non subducting tectonic plate at a convergent plate boundary. Materials in the accretionary wedge are usually marine sediments that are scrapped off from the down going slabs of oceanic crust. Elevated regions within the ocean basin are transported towards the subduction zones and accreted to the continental margin.
