1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ipatiy [6.2K]
3 years ago
12

How are so few producers able to support so many primary consumers?

Biology
1 answer:
avanturin [10]3 years ago
8 0

Answer:

Because primary producers get 100% energy consumption straight from the sun.

Explanation:

We use the energy pyramid to help us out:

.01% - A pex Predators

0.1% - Tertiary Consumers

1% - Secondary Consumers

10% - Primary Consumers

100% - Primary Producers

Because Primary Producers get 100% of the energy of the sun, they can support so many primary consumers, who only get 10% of the energy when they consume primary producers.

You might be interested in
Which body part is vestigial in humans?
Stels [109]

Answer:

The answer is the 2nd picture: the coccyx bone in humans.

Explanation:

Vestigial Structure:

Structures or anatomical features that do not currently serve a function is the bodily processes of a living organism. Vestiges are believed to have performed active functions in the organism's ancestors throughout its evolutionary history.

Coccyx Bone:

The coccyx or tailbone is an evolutionary remnant of our tree dwelling ancestors. Coccyx has no use in modern humans as we do not need to climb trees.

The coccyx in modern humans serves as an anchor for muscles.

5 0
3 years ago
You are an experienced naturalist and biologist and you observe two birds mating that you do not believe are members of the same
Zepler [3.9K]

Answer:

B) Post-zygotic factors prevented successful reproduction.

Explanation:

Postzygotic factors may influence the formation of the fertile offspring.

The postzygotic barriers basically involves the formation of the hybrid organisms which do not survive past the embryonic stages i-e hybrid inviability / the hybrid creation that is unable to form the offspring i-e sterile.

So , in the given scenario option B )Post-zygotic factors prevented successful reproduction is the right answer .

7 0
3 years ago
The muscle tissue in your heart is made up of what
blondinia [14]
Cardiac Muscle Tissue<span>. Cardiac </span>muscle tissue<span> is an extremely specialized form of </span>muscle tissue<span> that has evolved to pump blood throughout the body. In fact, cardiac </span>muscle<span> is only found in the</span>heart<span> and makes </span>up<span> the bulk of the </span>heart's<span> mass.</span>
8 0
3 years ago
PLEASE HELP ME PLEASE
VMariaS [17]

Most of the mutations have no effects whatsoever on the organisms but some can be dangerous. There are two types of mutations that cause harm to the organism's ability to survive:teratogen muations are the mutations that form inside the uterus when the fetus is still developing and can even kill it or cause severe malformations that lead to death in the early life. Carcinogen mutations are the ones that lead to the formation of neoplasms(masses of cells that divide uncontrollably, basicly cancer).

8 0
2 years ago
Driver mutations provide a growth advantage to a tumor cell. which type of mutation is known to accumulate in cancer cells but h
balu736 [363]

Examining tumor tissue for driver mutations can help plan treatments that stop cancer cells from growing.

tumors was EGFR, followed by TP53 (18%), SETD2 (11%) and SMARCA4 (11%). More than 72% (81/112) of cases have mutations in at least one driver gene.

For example, the TP53 tumor suppressor gene is a driver gene, but it is only functional when both alleles of her TP53 gene are mutated. Furthermore, mutations can act as drivers only at certain stages of cancer.

learn more about cancer here.  brainly.com/question/11710623

#SPJ4

5 0
2 years ago
Other questions:
  • Where do changes in an organism’s genes come from?
    8·1 answer
  • How do single celled organisms, like paramecium, adapt to living in a hypotonic environment?
    13·1 answer
  • Asked this question before, didn't really help so i'm asking again. also, please help.
    10·1 answer
  • During glycolysis, glucose is broken down into two molecules of pyruvate.
    6·2 answers
  • PLEASE HELP ME ASAP!!!
    14·1 answer
  • Who is the mole predator?
    14·1 answer
  • Flowers may be solitary, as in a zinnia or dahlia, or appear in clusters or a/an _______________, as in a/an _______________. g
    7·1 answer
  • In guinea pigs, the gene for black fur, B, is dominant over the gene for white fur, b. Complete the Punnett square below to show
    14·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • How is it possible for organisms to undergo both punctured equilibrium and gradualism?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!