1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marrrta [24]
2 years ago
10

What is one of the most important ways in which the organisms interact?

Biology
2 answers:
grigory [225]2 years ago
5 0
Competition and predation are one of the most important ways in which organisms interact
Lelu [443]2 years ago
3 0
What ways do organisms interact?-competition, predation, cooperation, symbiosis
-Competition: between same and different kinds of organisms, competes for available resources (food, light)
-Predation: between different kinds of organisms, hunt and kills each other in order to supply their energy (shelter)
-Cooperation: between same organisms, lives together and helps each other out (mates)
-Symbiosis: between different kinds or organisms, lives in close association with another kin of organism (space/territory)
You might be interested in
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Animals without a backbone are classified as ________. crustaceans invertebrates arthropods worms
CaHeK987 [17]
Invertebrates

in- = not
vertebra = spine
3 0
3 years ago
what inputs do plants need to carry out photosynthesis and how might you provide these on another planet
Fittoniya [83]
The inputs all plants need to carry out photosynthesis are water(H2O) + carbon dioxide (CO2) + sunlight
7 0
3 years ago
Read 2 more answers
Identify the correct sentence. A. As a young​ naturalist, Charles Darwin traveled around the world and made many discoveries on
Andreyy89

Answer:

A. As a young​ naturalist, Charles Darwin traveled around the world and made many discoveries on a small British navy​ ship, HMS Beagle.

6 0
3 years ago
Read 2 more answers
Which of the following is an example of a uniaxial joint?
Marysya12 [62]

Answer:

B . The hinge joint of the elbow.

Explanation:

Uniaxial joint allows for motion in a single phase.

8 0
3 years ago
Other questions:
  • In photosynthesis, what substances come in from the outside, what substances are produced
    11·2 answers
  • Who is good at biology and that can help me??????
    12·1 answer
  • Most of the energy in the typical animal cell is produced in the __________.
    5·1 answer
  • When light is refracted, the degree of bending is determined in part by?
    6·1 answer
  • The nurse is assessing a primipara's fundal height at 36 weeks' gestation and notes the fundus is now located at the xiphoid pro
    10·1 answer
  • Arrival of the electrical impulse causes neurotransmitters to diffuse across the _______ and bind to the next cell.
    13·1 answer
  • Mars facts and talk about mars
    6·2 answers
  • Bacteriophage t4 can adsorb to its host because of binding sites in its tail fibers that recognize areas of the e. Coli cell wal
    12·1 answer
  • 1 . What happens in the population if the mutation phenotype is helpful
    8·1 answer
  • How long does it take for an unburied body to decompose to a skeleton
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!