1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AleksandrR [38]
3 years ago
9

What is your mass in kilograms if you weigh 120 pounds? (there are approximately 2.2 pounds in one kilogram)Solve.

Biology
1 answer:
erma4kov [3.2K]3 years ago
7 0
120 lbs/ 2.2 lbs = 54.54 kg
You might be interested in
A father has two copies of a lactose persistence allele , he is homozygous dominant. The mother has one copy of that allele , sh
Contact [7]
The answer is C. ( use Punnett squares)
8 0
3 years ago
Read 2 more answers
Which component of a homeostatic system compares sensory information to a target value?
Katen [24]

<u>Answer:</u>

Integrator compares sensory information to a target value.

<u>Explanation:</u>

  • Integrator is responsible for sending 'instructions to an effector' based on 'sensory information' which eventually give responses.
  • These effectors execute the necessary changes required to adjust with the environment. Integrator act as the control centers.
  • Integrators send signals to the effectors after comparing the variables or changes at a definite set point.
  • However, its function mechanism is 'dependent on the feedback loop'.
8 0
3 years ago
How do the diet drugs lorcaserin and phentermine-topiramate help people lose weight? they reduce food absorption. they reduce bo
emmasim [6.3K]
<span>Diet drugs such as lorcaserin and phentermine-topiramate help people in losing weight by reducing food intake. These drugs are affecting the central nervous system, which act as an appetite suppressant where a person will not feel hungry or has lesser urge in eating does reducing his/her food intake. Weight loss will be much effective if these drugs will be adjunct with exercise and reducing caloric intake.</span>
3 0
3 years ago
What describes the physical expression of genes like having brown hair or having the ability to roll your tongue?
Tems11 [23]
I think the answer is B
4 0
3 years ago
Read 2 more answers
Questions are in the picture answer both plsss
vovangra [49]

Answer:

13. is Option J) all of the above

and 14 I'm not completely sure but I think its option D.

7 0
3 years ago
Other questions:
  • A blood pressure of 60 over 80 would indicate that a patient had…
    15·2 answers
  • Fossils cannot be used to explain changes in the earth.
    14·1 answer
  • An individual who displays the disease sickle-cell anemia must have inherited the deleterious allele from both phenotypically no
    10·1 answer
  • All scientific investigations begin with:
    5·2 answers
  • Why do shallow estuary waters create unique habitats for organisms living here?
    12·2 answers
  • What is the product of lactic acid fermentation
    15·1 answer
  • Of the more than 70 different ions that are dissolved in seawater the two most abundant _________.
    9·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What process takes place at the boundary between the capillaries and the alveoli?
    8·1 answer
  • What happens to macromolecules from food during digestion?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!