1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Liono4ka [1.6K]
3 years ago
15

BEST example of the sustainable use of a natural resource

Biology
1 answer:
frutty [35]3 years ago
4 0

Answer: The correct answer is option C, several governments agree to limit the amount of fish harvested from an ocean

Reason -

Sustainability is the process in which resources are utilized in an optimum way so that they don’t get extinct and thus they can be preserved for fulfilling the demands of next generation after the fulfillment of needs of the present generation. Here is this case, government aims at limiting fishing which will preserve the fish production  for future generation.

You might be interested in
Plants can grow successfully in soil that is considered sub-par if they have
yan [13]
A. Water. Because the roots grow in the dirt and they need water too grow.
8 0
3 years ago
Analysis of the second swab has confirmed that the causative organism is Streptococcus pyogenes, a gram-positive organism. Imagi
Agata [3.3K]

Answer:

d. purple, spherical-shaped organisms arranged in chainlike formations

5 0
3 years ago
Which food item contains a lot of processed simplw surgars
damaskus [11]

Answer: cookie

Explanation:

Dear your answer is here Lactose (milk sugar) is a carbohydrate that is formed by combining galactose and glucose monomers. It is found in food sources such as milk, yogurt, and cheese

6 0
3 years ago
Two differences between primary and secondary metabolites​
Scilla [17]

Answer:

Image result for Two differences between primary and secondary metabolites

Primary metabolites are not species-specific and thus might be identical in some organisms. Secondary metabolites are species-specific and thus are different in different organisms. Primary metabolites are involved in the growth, development, and reproduction of organisms.Aug 18, 2020

5 0
3 years ago
WILL IVE BRAIN?? Why might humans not have widespread regeneration abilities?
Murrr4er [49]

Answer: because mammals have more complex biological structures; limb regeneration would require sophisticated controls to ensure that limbs and organs don’t grow out of control.

Explanation:

8 0
3 years ago
Other questions:
  • On a rock outcrop that has never been home to living organisms, what is likely to be the first organism to grow there?
    6·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • During interphase where are chromosomes located within the cell
    12·1 answer
  • • What Is the difference between<br> cleaning, disinfecting, and sterilizing? ​
    11·2 answers
  • What happens during m phase of the cell cycle
    6·1 answer
  • Someone please help.
    14·1 answer
  • Hey guys i need help plz plz help i am giving all my points
    13·1 answer
  • Name some advantages and some disadvantages of overproduction of offspring
    8·1 answer
  • Help 20 points. science​
    11·1 answer
  • What statement best compares photosynthesis and cellular respiration?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!