1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tester [92]
3 years ago
15

The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG

GATAAACTC The left end of this molecule is the + end. How many amino acids will be in the protein translated from this sequence? tion) of the fo from this sequence The label on the end of the protein that is translated first is the # end.
Biology
1 answer:
olchik [2.2K]3 years ago
8 0

Answer:

According to the  number of sequence on DNA  there should be 10 amino acid. But after 7 amino acid there is stop codon so only 7 amino acid can be synthesized.

Explanation:

DNA sequence given here is CCTACCTTATGCCAAGTTGGGGATAAACTC it is read from left to right. When this DNA is transcribed mRNA sequence will be-

GGAUGGAAUACGGUUCAACCCCUAUUUGAG. These 30 nucleotide will synthesize following amino acids-

GAG  UUU  AUC  CCC  AAC  UUG  GCA  UAA  GGU  AGG-

Glutamine,  Phenylalanine,  Isoleusine,  Proline, Asparagine ,   Leucine,  Alanine,   stop codon.  As ribosome reach on stop codon protein synthesis stopped and process aborted.

You might be interested in
recently CA has been experiencing many wildfires to the point that many areas of land no longer have any living wildlife remaini
never [62]
Since the land will be cleared architect and house builders will probably go through that land and start building where the damage has been done.
5 0
4 years ago
can the behavior of a material or substance be considered a physical property? Explain why or why not. ​
mestny [16]

Answer:

yup it can be considered as the physical property like as if the solid is hard it can hurt to so it has the property of being hard and behavior of being hurted

4 0
3 years ago
Review Questions
mezya [45]

Answer:

6==. During spermatogenesis, four sperm result from each primary spermatocyte, which divides into two haploid secondary spermatocytes; these cells will go through a second meiotic division to produce four spermatids

7 0
3 years ago
Identify what Jean-Baptiste Lamarck believed about traits such as large muscles that are acquired during one's lifetime.
denis23 [38]
<span>What did Jean-Baptiste Lamarck believe about traits such as large muscles that are acquired during one's lifetime?

</span><span>They can be passed on to offspring.
</span>
<span>Jean-Baptiste Lamarck proposed that organisms have an innate tendency toward complexity and perfection.</span>
4 0
3 years ago
Describe the relationship<br> between variations and<br> adaptations?
laila [671]
Adaptations are physical or behavioral traits that make an organism better suited to its environment. Heritable variation comes from random mutations. Random mutations are the initial cause of new heritable traits. For example, a rabbit can't choose to have a different fur color.
mark brainlist plsss
3 0
3 years ago
Other questions:
  • A true breeding white squash (WWYY) is crossed with a true breeding green squash (wwyy) giving rise to a dihybrid offspring WwYy
    7·1 answer
  • PLZ HELPPPPPPP!!!!!!!
    9·1 answer
  • If someone who is trying to lose weight reduces their caloric intake by 800 kcal per day, and maintains the same calorie intake
    5·2 answers
  • Is there anything bad about lysosomes?
    14·1 answer
  • Two major dissolved gases in ocean water are
    8·2 answers
  • Which life functions do viruses not preform
    13·2 answers
  • Morgan breeds and sells snakes. He knows that he can make the most money by breeding and selling albino snakes. Albinism is a re
    10·1 answer
  • In Mendal's pea plant study, we find that a pea plants that have green pods are dominant while those that have yellow pods are r
    6·1 answer
  • I need help to get the right question because i got it wrong
    7·1 answer
  • 1. Define communicable diseases. Give three examples.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!