1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tester [92]
3 years ago
15

The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG

GATAAACTC The left end of this molecule is the + end. How many amino acids will be in the protein translated from this sequence? tion) of the fo from this sequence The label on the end of the protein that is translated first is the # end.
Biology
1 answer:
olchik [2.2K]3 years ago
8 0

Answer:

According to the  number of sequence on DNA  there should be 10 amino acid. But after 7 amino acid there is stop codon so only 7 amino acid can be synthesized.

Explanation:

DNA sequence given here is CCTACCTTATGCCAAGTTGGGGATAAACTC it is read from left to right. When this DNA is transcribed mRNA sequence will be-

GGAUGGAAUACGGUUCAACCCCUAUUUGAG. These 30 nucleotide will synthesize following amino acids-

GAG  UUU  AUC  CCC  AAC  UUG  GCA  UAA  GGU  AGG-

Glutamine,  Phenylalanine,  Isoleusine,  Proline, Asparagine ,   Leucine,  Alanine,   stop codon.  As ribosome reach on stop codon protein synthesis stopped and process aborted.

You might be interested in
4. What are carbon dioxide levels now? How often in the past 650,000 years have they been that high?
fgiga [73]

Answer:

Explanation:

Scientists at the Mauna Loa observatory in Hawaii say that CO2 levels in the atmosphere now stand at 387 parts per million (ppm), up almost 40% since the industrial revolution and the highest for at least the last 650,000 years.

4 0
3 years ago
What happens if you take more then 3 sleeping pills at once?<br>​
Mariana [72]

Answer:

It depends on the mg of pill, weight of your body and your body tolerance level.

3 0
2 years ago
What is a long term carbon sink?
vodka [1.7K]
Sink<span> is a </span>carbon<span> reservoir that is increasing in size, and is the opposite of a </span>carbon<span> "source". The main natural </span>sinks<span> are the oceans and plants and other organisms that use photosynthesis to remove </span>carbon<span> from the atmosphere by incorporating it into biomass.</span>
7 0
4 years ago
Cuadro sobre las barreras de la inmunidad
amm1812

El sistema inmune innato se compone principalmente de barreras físicas, como la piel y las membranas mucosas, barreras químicas, a través de la acción de péptidos antimicrobianos y especies reactivas de oxígeno [4], células inmunes innatas y mediadores solubles como el sistema del complemento, anticuerpos innatos

Explanation:

7 0
3 years ago
When you view the pendulum’s swing, it shows that at the very top of the swing KE = 0. What does that tell you about the pendulu
Harlamova29_29 [7]
At the very top of the swing the velocity=0. If the velocity is 0 then the kinetic energy is 0 as well because kinetic energy is the energy of movement.
8 0
3 years ago
Read 2 more answers
Other questions:
  • How many more trees are there in Canada than florida?
    5·1 answer
  • When light strikes the second medium what are the two things that happen?
    11·2 answers
  • A man has the A blood phenotype and his wife has the B blood phenotype. Their son has the O blood phenotype. Could this man be t
    12·1 answer
  • What can directly lead to unconformity on an exposed rock?
    10·1 answer
  • Which best describes a scientific theory?
    13·1 answer
  • Which statement about the nervous system is true?
    10·2 answers
  • Select all the correct answers.<br> Which two statements are true for the leading strand in DNA?
    13·1 answer
  • 1. What are some of the abiotic factors that scientists monitor when dealing with stream ecosystems?
    5·1 answer
  • In a large flock of 6520 sheep, 53 of them have yellow fat while the rest of the flock members have white fat. Yellow fat is inh
    5·1 answer
  • If the bacteria E.coli synthesize DNA at a rate of 100,000 nucleotides per min and takes 30 min to replicate the DNA how many ba
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!