1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tester [92]
3 years ago
15

The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG

GATAAACTC The left end of this molecule is the + end. How many amino acids will be in the protein translated from this sequence? tion) of the fo from this sequence The label on the end of the protein that is translated first is the # end.
Biology
1 answer:
olchik [2.2K]3 years ago
8 0

Answer:

According to the  number of sequence on DNA  there should be 10 amino acid. But after 7 amino acid there is stop codon so only 7 amino acid can be synthesized.

Explanation:

DNA sequence given here is CCTACCTTATGCCAAGTTGGGGATAAACTC it is read from left to right. When this DNA is transcribed mRNA sequence will be-

GGAUGGAAUACGGUUCAACCCCUAUUUGAG. These 30 nucleotide will synthesize following amino acids-

GAG  UUU  AUC  CCC  AAC  UUG  GCA  UAA  GGU  AGG-

Glutamine,  Phenylalanine,  Isoleusine,  Proline, Asparagine ,   Leucine,  Alanine,   stop codon.  As ribosome reach on stop codon protein synthesis stopped and process aborted.

You might be interested in
Suppose a woman with haplotype L1 and a man with haplotype L2 have a son. The son then marries a woman with haplotype L3. If thi
-Dominant- [34]

Answer:

AA AT TT

GG AG AG AG TG TG TG

GC AG AC AG TC

ó

AC TG TG TC

CC AC AC AC TC TC TC

Explanation:

Haplotype research served to discover the origin of genetic mutations that today manifest as pathologies.

It is very important to know that there are no equal haplotypes in two or more different humans.

They are the allelic constitution of multiple loci for the same chromosome.

Furthermore, haplotypes are very good for studying population genetics.

I leave you a table that will help you for this exercise or many more, where the haplotype system is outlined.

8 0
3 years ago
What property of the elements determines the charge the<br> element's ions will have?
Nesterboy [21]

Answer:

The answer is below with my explanation. ((:

Explanation:

The chemical properties of an element are determined by the configuration of its electrons in orbit around its nucleus. The number of electrons in orbit is equal to the number of protons in the nucleus (each proton has an an electrical charge of plus one, while each electron has the same charge only negative one).

I hope this helps :))

3 0
3 years ago
Read 2 more answers
Joints can be described by the amount of movement they allow. the three major classifications of functional joints are synarthro
svlad2 [7]
<span>Synarthrosis: immovable joint in which two bones are connected rigidly by fibrous tissue
</span><span>Amphiarthrosis: slightly movable joint in which the surfaces of bones are connected by ligaments or cartilage
</span><span>Diarthrosis: a joint that can move freely in various planes

Hope this helps!!(If it doesn't I'm sorry!)</span>
5 0
4 years ago
5. A causal relationship means one action or event is the cause of another. A correlational relationship describes a connection
katen-ka-za [31]

A statistical indication of the link between variables is a correlation. There is a cause-and-effect link between the variables; causality is the idea that changes in one variable create changes in the other. The two variables have a causal relationship as well as a correlation with one another.

What is causal relationship?

If the occurrence of one event results in the other, then there is a causal relationship between the two. The first incident is referred to as the cause, and the second incident as the effect. Two factors may correlate, but that does not prove one caused the other. On the other hand, two variables must be correlated if there is a causal connection between them.

According to a study, there is a link between a student's test-day anxiety and test results that is unfavorable. We cannot, however, conclude that test anxiety is to blame for a student's worse performance because there may be other factors at play, such as poor study habits. In this case, correlation does not prove causality.

For more information regarding causal relationship, visit:

brainly.com/question/11779181

#SPJ1

4 0
2 years ago
Milk
MissTica

Answer:

100gram

Hope it helps

Have a good day

3 0
3 years ago
Other questions:
  • What will be the result of photosystem II being exposed to less sunlight?
    9·2 answers
  • Duchenne muscular dystrophy is a serious condition caused by a recessive allele of a gene on the human x chromosome. The patient
    7·1 answer
  • High levels of _______________ are associated with states of mania.
    5·1 answer
  • bacteria that feed off of food in human gut and provide essential nutrients to their host are an example of
    10·2 answers
  • Earth has many different types of natural resources. The resources that can take centuries to millions of years to replenish are
    10·1 answer
  • Which of the following is a secondary color?<br> A. blue <br> B. orange <br> C. red <br> D. yellow
    11·1 answer
  • CO2 is an example of which type of bond?<br> metallic<br> ionic<br> covalent<br> O polar bonding
    7·1 answer
  • The government provides support for farms in many forms describe two examples of problems that farmers face and Outline how sub
    9·1 answer
  • Normal hemoglobin
    15·1 answer
  • Does Planet Nine follow Kepler’s Second Law?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!