1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tester [92]
3 years ago
15

The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG

GATAAACTC The left end of this molecule is the + end. How many amino acids will be in the protein translated from this sequence? tion) of the fo from this sequence The label on the end of the protein that is translated first is the # end.
Biology
1 answer:
olchik [2.2K]3 years ago
8 0

Answer:

According to the  number of sequence on DNA  there should be 10 amino acid. But after 7 amino acid there is stop codon so only 7 amino acid can be synthesized.

Explanation:

DNA sequence given here is CCTACCTTATGCCAAGTTGGGGATAAACTC it is read from left to right. When this DNA is transcribed mRNA sequence will be-

GGAUGGAAUACGGUUCAACCCCUAUUUGAG. These 30 nucleotide will synthesize following amino acids-

GAG  UUU  AUC  CCC  AAC  UUG  GCA  UAA  GGU  AGG-

Glutamine,  Phenylalanine,  Isoleusine,  Proline, Asparagine ,   Leucine,  Alanine,   stop codon.  As ribosome reach on stop codon protein synthesis stopped and process aborted.

You might be interested in
please match the following nutritional types with the statements that most accurately describe them, to test your understanding
svetlana [45]

Autotroph: a creature that obtains its carbon from inorganic carbon dioxide

Chemotroph: an organism that obtains energy from chemical substances-Heterotroph: an organism that must receive its carbon in an organic form

Phototroph: an organism that produces energy from sunlight

The term "primary nutritional groups" refers to a category of creatures that are separated into subcategories based on the sources of carbon and energy that they require for survival, growth, and reproduction. Carbon can come from organic or inorganic sources, and energy can be derived from either light or chemical molecules. ATP, carbs, or proteins are used to store the liberated energy as potential energy. The energy is eventually put to use for activities essential to life, like movement, growth, and reproduction.

learn more about Heterotroph here

brainly.com/question/25846728

#SPJ4

6 0
1 year ago
Reproductive system<br> Explain How does a fetus get nourishment up <br> until the time it is born?
Serjik [45]

Answer:

The fetus gets it's nourishment through the umbilical cord that is connected to the mother's uterus

4 0
3 years ago
A ________ is where one network ends and another begins.
umka21 [38]

A demarc is where one network ends and another begins. Demarc stands for demarcation point. It is the physical point at which the public network of a telecommunications company ends and the private network of a customer begins.

However, the distinction between where one category of network begins and another ends is sometimes blurry.

6 0
3 years ago
Match the following. 1. the basic building block of all forms of life resolving power 2. the idea of Schleiden and Schwann that
Roman55 [17]

Answer:

1. Cell

2. cell theory

3. Organismal theory

4. resolving power

Explanation:

The cell is the smallest known unit of all living organisms. They are called the building blocks of life. An organism can be unicellular (made up of one cell) or multi-cellular (made up of many cells).

2. Cell theory was formulated and developed  by Schleiden, Schwann, and Virchow. They are considered as the basic principles of biology.

It states:

1. Living organisms are made up of cells.

2. Cells are the basic unit of life.

3. Cells are formed from pre-existing cells.

4. Energy flows inside the cell.

5. DNA is passed on from cell to cell.

6. All cells have the same basic chemical composition.

3. Organismal theory is the intended counter-argument of the cell theory. It was developed by Reichert, Strasberger, Sherrington, and Pavlov. It argues that the basic unit of life is the organism itself, suggesting that an organism came about from a cell that expanded.

4. Resolving power is the ability of an optical instrument like a microscope or a telescope to view objects that are close together as separate, abling the viewer to distinguish the two from each other.

5 0
2 years ago
What is the largest sediment that can be transported by a stream that has a velocity of 50 cm/sec?
elena55 [62]

Answer:

What is the largest sediment that can be transported by a stream that has a velocity of 50 cm/sec?What is the largest sediment that can be transported by a stream that has a velocity of 50 cm/sec?

Sand is the only sediment that could be transported at that velocity as others are heavy to be transported with the mentioned velocity

Explanation:

8 0
3 years ago
Other questions:
  • Is oil a renewable or nonrenewable resource? Why?
    10·2 answers
  • How do nitrates get into the surface water
    9·1 answer
  • Which process is not correctly matched with its cellular location? glycolysis = cytoplasm citric acid cycle = mitochondria elect
    9·2 answers
  • Bacteria with appendages 1. do not exist. 2. possess tubular or stalk-like extensions of their cells. 4. have the basic characte
    11·1 answer
  • Neostigmine is an indirect-acting anticholinesterase drug that is used to treat urinary retention by: Multiple Choice1. increasi
    14·1 answer
  • Which graph best shows the general effect that differences in elevation above sea level have on the average annual temperature?
    11·1 answer
  • A group of atoms such as OH is called a(n)?
    7·1 answer
  • Can someone answer: A very bright, young galaxy with a giant black hole in the center is called a ______________?
    9·2 answers
  • Which gas in the atmosphere might decrease?
    12·1 answer
  • Why do ruminants digest their food in 2 steps
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!