1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tester [92]
3 years ago
15

The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG

GATAAACTC The left end of this molecule is the + end. How many amino acids will be in the protein translated from this sequence? tion) of the fo from this sequence The label on the end of the protein that is translated first is the # end.
Biology
1 answer:
olchik [2.2K]3 years ago
8 0

Answer:

According to the  number of sequence on DNA  there should be 10 amino acid. But after 7 amino acid there is stop codon so only 7 amino acid can be synthesized.

Explanation:

DNA sequence given here is CCTACCTTATGCCAAGTTGGGGATAAACTC it is read from left to right. When this DNA is transcribed mRNA sequence will be-

GGAUGGAAUACGGUUCAACCCCUAUUUGAG. These 30 nucleotide will synthesize following amino acids-

GAG  UUU  AUC  CCC  AAC  UUG  GCA  UAA  GGU  AGG-

Glutamine,  Phenylalanine,  Isoleusine,  Proline, Asparagine ,   Leucine,  Alanine,   stop codon.  As ribosome reach on stop codon protein synthesis stopped and process aborted.

You might be interested in
A scientist in new York has been measuring the pH of rainfall in that state for the last 10 years. He has determined that the pH
malfutka [58]

Answer:

4.22

Explanation:

pH scale ranges from 0-14. 0-7 being the acidic range with 0 being the most acidic, 7 -14 is the basic range with 14 being the most basic.

7 0
3 years ago
Read 2 more answers
Energy moves in the form of energized.......?
insens350 [35]
 <span>Actually energy is the capacity to do work. It is not moving. It is transmitted, propagated, dissippated, or radiated. It depends upon what type of energy it is. Heat energy is dissippated through conduction, convection or radiation. For conduction the particles must be in contact. For convection the particles which posses the energy must ba able to move about. For radiation, even without a material medium the energy is transmitted in the form of waves. Eg. energy from the sun. When a stone is dropped in still water the energy is imparted to the water surface. This energy is distributed all over the water surface in the form of circular waves (ripples). Electrical energy - through conducting wires or electromagnetic radiation. Light energy & sound energy are through waves.</span>
3 0
3 years ago
Jay, Kip, and Tia are each measuring the concentration of a solution. They are doing experiments separately. They are all are us
Anestetic [448]
The measurements taken by Jay are least likely to contain random errors.

When you increase the number of measurements, the random errors tend to minimize, because errors in one direction cancel with errors in the opposed direction.
8 0
3 years ago
What molecule makes the trunk of a tree sturdy
kirill115 [55]

Answer:

Cellulose

Explanation:

trunk is the main axis of a tree that supports the branches and is supported by roots. Cellulose makes it sturdy. Cellulose is the main substance in the walls of plant cells, helping them to remain stiff and upright.

3 0
3 years ago
Picture question? What is the answer please help
mina [271]

The answer is false there were only types the saurischians and the ornithischians.

5 0
3 years ago
Other questions:
  • 3 alternative energy sources
    12·2 answers
  • Top-down processing occurs when individuals detect and combine specific features of a stimulus into a more complex form in order
    5·1 answer
  • Which of the following steps in prokaryotic binary fission is correct?
    12·1 answer
  • Multicellular organisms reproduce by binary fission<br><br> A. True<br> B. False
    12·1 answer
  • 1. Five students in your class always sit together in the front row. This could be because (A) they really like each other or (B
    11·2 answers
  • a semipermeable membrane has an 8 percent salt solution on the left side and a 9 percent salt solution on the right side. What w
    15·2 answers
  • Which statement about enzymes is true?
    9·1 answer
  • 50 POINT + BRAINLYEST PLZZZZ UNGENTS!!
    12·1 answer
  • Define target cell and explain why all cells are not target cells for all hormones
    13·1 answer
  • What does a plant need to create a glucose molecule in photosynthesis?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!