1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tester [92]
3 years ago
15

The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG

GATAAACTC The left end of this molecule is the + end. How many amino acids will be in the protein translated from this sequence? tion) of the fo from this sequence The label on the end of the protein that is translated first is the # end.
Biology
1 answer:
olchik [2.2K]3 years ago
8 0

Answer:

According to the  number of sequence on DNA  there should be 10 amino acid. But after 7 amino acid there is stop codon so only 7 amino acid can be synthesized.

Explanation:

DNA sequence given here is CCTACCTTATGCCAAGTTGGGGATAAACTC it is read from left to right. When this DNA is transcribed mRNA sequence will be-

GGAUGGAAUACGGUUCAACCCCUAUUUGAG. These 30 nucleotide will synthesize following amino acids-

GAG  UUU  AUC  CCC  AAC  UUG  GCA  UAA  GGU  AGG-

Glutamine,  Phenylalanine,  Isoleusine,  Proline, Asparagine ,   Leucine,  Alanine,   stop codon.  As ribosome reach on stop codon protein synthesis stopped and process aborted.

You might be interested in
Can someone please help me with this
alex41 [277]

Answer:

The answers is D option why because when he jumps and goes down with a force and opens parachute so lesser force with his acceleration

4 0
2 years ago
Suppose a rancher wants to raise cattle. Design a plan to help the rancher determine how much land she'll need based on the ener
BARSIC [14]

Answer:

The energy flow in the ecosystem decreases as it flows from one trophic level to the next trophic level. Only 10% of the energy will transfer to the next trophic level and the remaining energy is lost in the other metabolic process.

The energy flow in the case of the grassland can be shown by the trophic relationship of the organisms. The sun is the primary source of the energy that are absorbed by the plants through the photosynthesis process. The cattle acts as herbivores will consume the plants energy by directly feeding on them. The ranch should be protected from the other animals that feeds on cattle and they are known as carnivorves.

4 0
3 years ago
Describe the characteristics of fungi.
Ksju [112]

Answer:

Characteristics of Fungi

Fungi are eukaryotic, non-vascular, non-motile and heterotrophic organisms.

They may be unicellular or filamentous.

They reproduce by means of spores.

Fungi exhibit the phenomenon of alternation of generation.

Fungi lack chlorophyll and hence cannot perform photosynthesis.

6 0
2 years ago
What is the Jet Stream
Norma-Jean [14]
A flow of exhaust gasses from a jet engine
8 0
2 years ago
Read 2 more answers
In which phase do homologous chromosomes migrate to towards the metaphase phase?
shtirl [24]
C Chromosomes break at centromeres,and sister chromatids move to opposite ends of the cell.
4 0
2 years ago
Other questions:
  • Why do substances and circumstances sometimes harm the fetus and sometimes have no impact?
    6·1 answer
  • Humans have fewer bones as adults than they did at birth?<br> Is it true or false
    12·2 answers
  • Can you count how old the tree was?
    8·2 answers
  • most conifers do not lose their needles every fall. How might this extend of conifer's growing season?
    6·1 answer
  • Which statement best explains how form and function are related?
    11·1 answer
  • If you were to extend the prim meridian from point O to the equator how many degrees longitude would it be and what would thus l
    8·1 answer
  • Converting uranium to thorium by decreasing the number of protons from 92 to 90 and decreasing the number of neutrons from 146 t
    7·1 answer
  • What is the major cavity for brain
    7·1 answer
  • What percentage of Earth’s surface is covered by water?
    9·2 answers
  • The asthenosphere and lithosphere are parts of earths
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!