1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tester [92]
3 years ago
15

The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG

GATAAACTC The left end of this molecule is the + end. How many amino acids will be in the protein translated from this sequence? tion) of the fo from this sequence The label on the end of the protein that is translated first is the # end.
Biology
1 answer:
olchik [2.2K]3 years ago
8 0

Answer:

According to the  number of sequence on DNA  there should be 10 amino acid. But after 7 amino acid there is stop codon so only 7 amino acid can be synthesized.

Explanation:

DNA sequence given here is CCTACCTTATGCCAAGTTGGGGATAAACTC it is read from left to right. When this DNA is transcribed mRNA sequence will be-

GGAUGGAAUACGGUUCAACCCCUAUUUGAG. These 30 nucleotide will synthesize following amino acids-

GAG  UUU  AUC  CCC  AAC  UUG  GCA  UAA  GGU  AGG-

Glutamine,  Phenylalanine,  Isoleusine,  Proline, Asparagine ,   Leucine,  Alanine,   stop codon.  As ribosome reach on stop codon protein synthesis stopped and process aborted.

You might be interested in
The zinc chloride produced by the reaction is in what state
ANEK [815]

Answer: Solution in Water

Explanation:

I believe this refers to the reaction between Zinc and Hydrochloric acid.

When this happens, the solution will be Zinc Chloride but as it happened in a solution (the acid), the resulting Zinc Chloride salt would be in aqueous form which means that it would be a solution in water which is the other product of this reaction.

Had the zinc reacted with gaseous HCI, it would have resulted in a Zinc Chloride with no liquid in it.

4 0
2 years ago
Members of the kingdom Plantae differ from members of the other kingdoms of Eukarya in that most members of the kingdom Plantae
Nady [450]

Answer:

Explanation: Members of Kingom Plantae are autotrophs, meaning they produce their own food via photosynthesis. They are multicellular organisms. On a cellular level, members of Kingdom Plantae have cell walls ( members of Kingdom Animalia lack cell walls in their cells, but have red blood cells instead)

3 0
3 years ago
What is happening when cells start to swell up with water?
marin [14]
When cells start to swell up with water, Osmosis takes place.
6 0
3 years ago
Read 2 more answers
If oxygen moves from an area of high concentration outside of the cell to low concentration inside the cell, which method of mov
motikmotik

Answer:

B.) Diffusion

Explanation:

Since this is oxygen, not water, and it is going from an area of high concentration to low, it is moving with its concentration gradient, it would be diffusion. If it were water, not oxygen, then it would be osmosis, and lastly, if it were moving from an area of low to high concentration, that would be active transport. Semipermeability is a characteristic of cell membranes, not a method of movement.

7 0
3 years ago
Read 2 more answers
PLEASE SOMEONE HELP ME PLEASE!!!
Cerrena [4.2K]

Answer:

bananas is the answer because there good

4 0
3 years ago
Other questions:
  • Choose one of the factors that threatens biodiversity and suggest one way in which biodiversity can be preserved in a real-live
    7·1 answer
  • Why do we describe the information contained in the nucleus as hereditary
    14·1 answer
  • Which best describes the role of a primary consumer in a food web?
    7·1 answer
  • What is a zodiac sign?
    8·2 answers
  • Which of the following statements is true?
    8·1 answer
  • 4. What advantage do plankton gain by storing lipids within their bodies?
    10·1 answer
  • 3. One of the most common carcinoma of
    15·1 answer
  • Tetracycline is an antibiotic that blocks tRNA from entering the ribosome and associating with mRNA. If tetracycline were added
    9·1 answer
  • Explain why nitrogen Is Important to organisms. A:Nitrogen is necessary in order for organisms to reproduce. B:Nitrogen is neces
    8·1 answer
  • An animal is grouped as an insect if it has:
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!