1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tester [92]
3 years ago
15

The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG

GATAAACTC The left end of this molecule is the + end. How many amino acids will be in the protein translated from this sequence? tion) of the fo from this sequence The label on the end of the protein that is translated first is the # end.
Biology
1 answer:
olchik [2.2K]3 years ago
8 0

Answer:

According to the  number of sequence on DNA  there should be 10 amino acid. But after 7 amino acid there is stop codon so only 7 amino acid can be synthesized.

Explanation:

DNA sequence given here is CCTACCTTATGCCAAGTTGGGGATAAACTC it is read from left to right. When this DNA is transcribed mRNA sequence will be-

GGAUGGAAUACGGUUCAACCCCUAUUUGAG. These 30 nucleotide will synthesize following amino acids-

GAG  UUU  AUC  CCC  AAC  UUG  GCA  UAA  GGU  AGG-

Glutamine,  Phenylalanine,  Isoleusine,  Proline, Asparagine ,   Leucine,  Alanine,   stop codon.  As ribosome reach on stop codon protein synthesis stopped and process aborted.

You might be interested in
A dihybrid cross is performed between plants that differ in two Mendelian traits: Stem length (T or t) and flower coloration (R
Dahasolnce [82]

Answer:

A. 3/16

Explanation:

The four possible outcomes for Stem length are:

Tt, tT, TT and tt.

The dominant trait (tall stems) will manifest itself in 3 out of 4 outcomes, so its ratio is 3/4.

The four possible outcomes for flower coloration are:

Rr, rR, RR and rr.

The non-dominant trait (white flowers) will manifest itself in 1 out of 4 outcomes, so its ratio is 1/4.

Multiplying both ratios gives us the ratio of offspring that have tall stems and white flowers:

\frac{3}{4}*\frac{1}{4}=\frac{3}{16}

Therefore, the answer is A. 3/16

4 0
2 years ago
When plants wilt they're soft stems and leaves begin to drop what is going on inside the plant cells that causes the plant to dr
Nat2105 [25]
The cell membranes begin to come apart when there is insufficient water around the cells. The cytoplasm of the cells becomes more concentrated, which slowly poisons the cells. The cell walls become brittle as they dry out, and some of them collapse. The central vacuoles in the cells lose water and can no longer help support the cells.


The central vacuoles in the cells lose water and can no longer help support the cells
3 0
2 years ago
PLEASE ANSWER FOR BRAINLIEST
BigorU [14]
2. During differentiation, certain genes are activated to produce proteins that enable specific functions.

3. Meiosis results in offspring with genotypes that are not exact copies of the parents.

4. DNA replication occurs before the division of the nucleus.

5. I can't answer without the image.

6. ovary cells (and testes in males)

7. I can't answer without the image.

8. It was passed to the individual by a gamete from the father.

9. 3n

11. Need the diagram.
5 0
3 years ago
I WILL GIVE BRAINLIEST!!!
frutty [35]

Explanation:

50% chance of a having a girl without the disease who is a carrier. This means that none of his children would actually show the signs ... choice A.

4 0
2 years ago
Read 2 more answers
Before the widespread use of antibiotics, there were very low levels of antibacterial resistance. As antibiotic use has grown, s
Arisa [49]

Answer:

This is because antibiotic resistance can be caused by bacteria getting the ability to be unaffected by the antibiotics Also, people not taking their medication for the entire duration exposes the bacteria to the antibiotic and makes it stronger. Also, when people overuse antibiotics and mutations occur, the bacteria becomes antibiotic resistant.

5 0
2 years ago
Other questions:
  • New ecosystems have been created by human land use. Please select the best answer from the choices provided T F
    8·2 answers
  • How many phenotypes are present
    12·1 answer
  • explain how high blood cholesterol develops and someone with a genetic disorder versus someone who is a high fat diet
    7·1 answer
  • Which type of gene is most likely to be widely expressed in the body of someone who has a superficial scrape?
    11·2 answers
  • A solution that contains equal numbers of hydrogen and hydroxyl ions would be called _____. Acidic, basic, alkaline ,or neutral
    9·1 answer
  • What quantity is a measurement of energy used? A 15 liters B 6 joules C 60 milligrams or D 24 meters per second?
    11·1 answer
  • Discuss how climate change, overpopulation, or a local environmental issue may have impacted land or aquatic biomes. Was the imp
    5·1 answer
  • 50 POINT + BRAINLYEST PLZZZZ UNGENTS!!
    12·1 answer
  • 6.
    5·2 answers
  • Does anyone know the answer
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!