1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tester [92]
3 years ago
15

The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG

GATAAACTC The left end of this molecule is the + end. How many amino acids will be in the protein translated from this sequence? tion) of the fo from this sequence The label on the end of the protein that is translated first is the # end.
Biology
1 answer:
olchik [2.2K]3 years ago
8 0

Answer:

According to the  number of sequence on DNA  there should be 10 amino acid. But after 7 amino acid there is stop codon so only 7 amino acid can be synthesized.

Explanation:

DNA sequence given here is CCTACCTTATGCCAAGTTGGGGATAAACTC it is read from left to right. When this DNA is transcribed mRNA sequence will be-

GGAUGGAAUACGGUUCAACCCCUAUUUGAG. These 30 nucleotide will synthesize following amino acids-

GAG  UUU  AUC  CCC  AAC  UUG  GCA  UAA  GGU  AGG-

Glutamine,  Phenylalanine,  Isoleusine,  Proline, Asparagine ,   Leucine,  Alanine,   stop codon.  As ribosome reach on stop codon protein synthesis stopped and process aborted.

You might be interested in
True or false? <br> Density is equal to the mass of an object divided by its volume.
kramer

Answer:

True

Explanation:

The formula for density is

p = m/v

density = mass ÷ volume

4 0
3 years ago
Read 2 more answers
Where does the carbon in fossil fuels come from?
fiasKO [112]

Answer: Fossil fuels are made up of dead plant life example trees, bushes, etc., and when burned they release carbon in the air

4 0
3 years ago
What is the process of Hot lava cooling and hardening called?
Kipish [7]

What is it called when lava cools and hardens? Sometimes magma flows upward and is forced out onto the earth's surface during a volcanic eruption. Magma that reaches the surface of the earth is called lava. When it cools and hardens, it too forms igneous rock. Igneous rock that is formed on the earth's surface is described as extrusive.n:

8 0
2 years ago
Research studies suggest that a high-fiber diet protects against _____.
s344n2d4d5 [400]

Research studies suggest that a high-fiber diet protects against colon cancer. This is because high fibrous food increases the bulk in the digestive tract to pass easily through the intestinal tract to shorten the time of passage. This short time of passage of food reduces the interaction of carcinogens present in the food with the intestinal tract. The fibers are broken down in butyrate by the bacteria present in the lower intestine. This butyrate inhibits the growth of tumors of colon and rectum,

3 0
3 years ago
What is a group of specialized cells called when they work together to perform a specific function? (5 points) Atom Organ Organ
Mrac [35]
We have just done this triangle so it may help you with the answer

8 0
3 years ago
Read 2 more answers
Other questions:
  • What conditions cause the contractile vacuole to fill with water?
    9·2 answers
  • Which of the following methods might be used to decrease the rate of approach to carrying capacity by the developed world?
    12·1 answer
  • In green leaves light absorbing compound called pigments are made of
    12·2 answers
  • One way to avoid an overgrouth of toxin-producing algae would be to reduce or eliminate
    15·1 answer
  • How often does oxygen cycle through the atmosphere?
    6·2 answers
  • Which length is usually measured in micrometers?
    15·1 answer
  • Which of the statements are ways that modern geneticists are addressing medical, social, or industrial problems?
    8·1 answer
  • Genome is to individual, as _____________ is to population:
    13·1 answer
  • Wildlife biologists treated a pool with a chemical to reduce the amount of algae. A(t)=35t-360t+1050
    7·1 answer
  • 70 points! Earthquakes are the result of movement of the Earth's crust along fault lines both within and along tectonic plate bo
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!