1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tester [92]
3 years ago
15

The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG

GATAAACTC The left end of this molecule is the + end. How many amino acids will be in the protein translated from this sequence? tion) of the fo from this sequence The label on the end of the protein that is translated first is the # end.
Biology
1 answer:
olchik [2.2K]3 years ago
8 0

Answer:

According to the  number of sequence on DNA  there should be 10 amino acid. But after 7 amino acid there is stop codon so only 7 amino acid can be synthesized.

Explanation:

DNA sequence given here is CCTACCTTATGCCAAGTTGGGGATAAACTC it is read from left to right. When this DNA is transcribed mRNA sequence will be-

GGAUGGAAUACGGUUCAACCCCUAUUUGAG. These 30 nucleotide will synthesize following amino acids-

GAG  UUU  AUC  CCC  AAC  UUG  GCA  UAA  GGU  AGG-

Glutamine,  Phenylalanine,  Isoleusine,  Proline, Asparagine ,   Leucine,  Alanine,   stop codon.  As ribosome reach on stop codon protein synthesis stopped and process aborted.

You might be interested in
How much DNA is located in an egg cell BEFORE fertilization?
natali 33 [55]

Answer:

B. 50%

Explanation:

6 0
4 years ago
Read 2 more answers
Glucose is a large molecule that cannot penetrate the phospholipid bilayer of cells. Instead, glucose enters most cells through
bagirrra123 [75]


The term is Facilitated diffusion.

Facilitated diffusion is a transport mechanism in which carrier proteins shuttle molecules across the cell membrane without using the cell's energy, and because it does not use the cell's energy, it is a passive transport.

The energy is provided by the concentration gradient, which means that molecules are transported from higher  to lower concentrations, into or out of the cell.

The carrier proteins of the GLUT family are responsible for transporting glucose. They bind to glucose , which causes them to change shape to fit in the membrane passage then they translocate the glucose molecule from one side of the membrane to the other.

Red blood cells use facilitated diffusion to absorb glucose.

5 0
3 years ago
Which of the following best describes how the first organic molecules on the early Earth may have been formed?
GuDViN [60]
Wow! this si a huge question but analyzing all the datils from ths option you give me I have to say that C option: <span>Heat energy became trapped in the atmosphere by greenhouse gases and was used as an energy source in the building of macromolecules, is the one that gets closer to what the scientists have said recently. Take into account for example, the examinations of Dr. Stanley Millers. I think this can help you</span>
4 0
3 years ago
One difference between transcription and DNA replication is that:
Grace [21]

Answer:

D

Explanation:

DNA use thymine and rna uses uracil but they use a,c,g together

7 0
4 years ago
Eukaryotes can have both the mitochondria and chloroplasts.<br> True<br> O False
lara [203]

Answer:

False

Explanation:

Eukaryotes include animal cells which do not have chloroplasts

6 0
4 years ago
Other questions:
  • What four things need to be maintained when maintaining homeostasis
    10·2 answers
  • Animals eat other organisms to obtain food. They then break down the food to get energy and rearrange the molecules of their foo
    10·1 answer
  • How does the molecular clock work?
    11·2 answers
  • What happens when you eat more than your body needs for energy?
    7·1 answer
  • Crude oil goes through ________ to separate the parts by weight.
    5·1 answer
  • Vascular plants help maintain the water cycle. which property ot these plants enables them to carry out this function?
    7·1 answer
  • Translation involves several different types of tRNA molecules. Which statement best describes how tRNA molecules assemble amino
    5·1 answer
  • Which of the following is NOT found in tRNA?
    6·1 answer
  • Why are orcas having trouble reproducing?
    15·2 answers
  • What is the twisted ladder shape of the DNA called?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!