1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
umka21 [38]
3 years ago
6

Giraffes can grow up to 6 yards how tall will that be in feet?

Biology
1 answer:
natita [175]3 years ago
5 0
I believe it would be 18 feet..
You might be interested in
In the sweet pea crossing experiment by Bateson and Punnet, the F2 generation had many more offspring with the phenotypes of pur
gizmo_the_mogwai [7]

Answer:

The F2 generation can be explained because the alleles for flower colour and pollen shape are linked.

Explanation:

<em>When two alleles are linked on the same chromosome, there is a high tendency for the alleles to be inherited together. Consequently, the frequency of the alleles recombining in subsequent generations is low.</em>

This is what Bateson and Punnet observed. There exist a linkage between P and L alleles and also p and l alleles, thereby increasing their frequencies  of occurring together and decreasing the frequency of their recombination.

Thus, the F2 generation observed by Bateson and Punnet is due to linkage of alleles.

3 0
3 years ago
An unknown mineral scratches apatite and is scratched by corundum. What can you conclude about this mineral’s hardness?
Gala2k [10]

If we guide ourselves with the Moh´s scale:

Material scratches apatite → material is harder than 5.

Material is scratched by corundum → material is softer than 9.

Conclusion:

The hardness of the unknown material stands between 5 and 9.

Note:  

Both apatite and corundum are defining materials (reference materials in the Moh´s scale). So, you can also give an answer using defining materials:

"It can either be an orthoclase feldspar, a quartz or a topaz".

Hope it helped,

BiologiaMagister

<u><em>This answer is dedicated to JaySL</em></u>

8 0
3 years ago
Read 2 more answers
Granite forms when liquid magma slowly cools within the Earth's crust. Basalt can form when lava cools on Earth's surface. What
FinnZ [79.3K]

Answer:

well in some cases granite is not in fact allowed to from bacause many popele said no.

Explanation:

you see here i have no idea waht this is because i m not in this class but  

       

5 0
2 years ago
Read 2 more answers
Which organism would make a good bioindicator?
Lunna [17]
I think the answer is b.
3 0
2 years ago
Read 2 more answers
there are multiple chickens and rabbits in a cage there are 72 heads and 200 feet inside of the cage how many chickens are in th
schepotkina [342]
The answer is 44 chickens and 28 rabbits.

We have a system of two equations.
x - the number of rabbits
y - the number of chickens

Both chicken and rabbit have only 1 head, so the first equation is: x + y = 72.
Since rabbits have 4 legs and chickens 2 legs, the second equation is: 4x + 2y = 200.

Now, let's solve the system:
x + y = 72
4x + 2y = 200
___________
y = 72 - x
⇒ 4x + 2 · (72 - x) = 200
4x + 2 · 72 - 2 · x = 200
4x + 144 - 2x = 200
2x + 144 = 200
2x = 200 - 144
2x = 56
⇒ x = 56 ÷ 2 = 28
So, there are 28 rabbits.

Since
y = 72 - x = 72 - 28 = 44,
there are 44 chickens.

7 0
3 years ago
Other questions:
  • The esophagus and trachea are both open to the ______.
    13·2 answers
  • The nursing instructor is teaching a group of students about preconception counseling and care. the student nurse asks the nurse
    7·1 answer
  • The most abundant producer in aquatic ecosystems are
    13·1 answer
  • A species of lizards migrates to a group of islands in the ocean. Over time, they diversified and evolved into several different
    8·2 answers
  • When do scientists consider a hypothesis valid?
    13·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Write one scientific question about the organism in the photo
    13·1 answer
  • Plant cells have a large membrane-bound space in which water, waste products, and nutrients are stored. This place is known as a
    7·1 answer
  • Most protists are______.<br> A)Unicellular<br> B)Heterotrophs<br> C)Autotrophs<br> D)Multicellular
    12·1 answer
  • arrange the organisms from fastest to slowest based on the the time theyd take to complete the 20th carnegie stage
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!