1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anastasy [175]
3 years ago
14

17. Describe how antibiotic resistance in bacteria forms, making sure to explain how humans cause this change to occur.Discuss 3

things we humans can do to reduce the occurrence of antibiotic resistance.

Biology
1 answer:
Vera_Pavlovna [14]3 years ago
5 0
Overuse of antibiotics is causing this resistance, we can let our bodies fight off bacterial infections naturally, stop the overuse of antibacterial soaps and cleansers, let our bodies build up resistance to these bacterias naturally through natural exposure.
You might be interested in
Which of the following is not an example of diffusion?
Vikki [24]
A because it’s not wasting more just soreading
3 0
2 years ago
(1) How do the Kidneys clean the blood?. A) by breaking down nutrients. B) kidneys clean the blood by filtering it to remove was
KonstantinChe [14]
The correct answer for this question is: "<span>B) kidneys clean the blood by filtering it to remove wastes." Kidneys clean the blood by filtering it and removing the waste.

The correct answer for this question is: "</span><span>A) secretes excess water as sweat." The role of the skin in the excretory system is to secrete waste and excess water as sweat.</span>
7 0
3 years ago
Read 2 more answers
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
All of the following are examples of informational social influence except:
Cerrena [4.2K]

Answer:

c. when you get to college you change the way you dress so that you "fit in" better--that is, so that people will like you more.

Explanation:

Informational social influence leads to internalization (private acceptance) of the majority opinion/behaviour i-e you actually change your attitude / belief. It is basically a difficult task , unsure of the answer, usually ambiguous , actually use others's response to form an opinion and actually believe what others say and internalize in. It is usually found in the crisis situation, when you don't know what to do and following th advice of expert. Examples include listening to fireman.

Hence in the given options, only c. when you get to college you change the way you dress so that you "fit in" better--that is, so that people will like you more. seems not to be example of Informaltiona social influence.

3 0
3 years ago
What are the types of gametes​
Vika [28.1K]

In certain organisms, like humans, there are two morphologically distinct types of gametes: (1) the male gamete (i.e. sperm cell) and (2) the female gamete (i.e. ovum). The male gamete is smaller in size and motile whereas the female gamete is several times bigger and non-motile. The haploid condition of the two gametes is essential so that at fertilization during sexual reproduction the integrity of the chromosomal number is maintained throughout generations.

Hope this helps.

5 0
3 years ago
Read 2 more answers
Other questions:
  • What are two ways that your body uses carbohydrates?
    14·1 answer
  • If a cell is place inside a solution that has a higher concentration of solute than on the inside of the cell, what can be said
    9·1 answer
  • Chromosomes contain the genetic code that controls inherited traits. Describe the typical set of human chromosomes in each cell
    7·1 answer
  • In the emergency department, a client arrives following a car accident. His pulse is 122; BP 88/60; respiration is 18 bpm. Urine
    9·1 answer
  • How could an error during transcription affect the protein that is produced?
    14·2 answers
  • Why accleration is a derived quantity​
    14·1 answer
  • May someone please help me ?
    15·2 answers
  • Which statement best explains the students'
    10·1 answer
  • A 2016 experiment by researchers at UC Irvine established a link between autonomic nervous system activity during sleep and memo
    11·1 answer
  • Smooth muscle, which is a tissue made up of a type of specialized muscle cell, functions in which process?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!