Answer:
5-10 days to get to the waking faze
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
On this World Meteorological Day, celebrated each year on March 23, we climb far above the Earth for a view of the southern Peruvian coast courtesy of the Landsat 8 satellite. Below the clouds, at the bottom of those canyons, are the Yauca and <span>Acarí </span>Rivers, which drain into the Pacific. As any good meteorologist taking a break from today’s celebrations will tell you, warm air from the equator forms a layer over the cool coastal air here, pushing the clouds into the deep river canyons and covering the Pacific Ocean shore.
The Prime Meridian separates the Western and Eastern Hemispheres . The Equator separates the Northern
Answer:
The correct answer would be allergies.
Allergies is one of the common disadvantages of recombinant DNA technology.
It has been observed that use of genetically modified crops can cause life-threatening allergies.
The possible reason is that the introduction of new genes in the crops may lead to the formation of new proteins our body has never encountered with. These proteins may have a potential to cause allergies or any other life-threatening diseases or complications.