1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nesterboy [21]
3 years ago
14

Which statements about heat are true?

Biology
1 answer:
MariettaO [177]3 years ago
5 0
The answer is b. hope this helps
You might be interested in
Where does the energy stored in fossil fuels come from?.
ValentinkaMS [17]

Answer: The energy comes from the sun.

Explanation:

6 0
2 years ago
Read 2 more answers
Please halp mehhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
slava [35]

Answer:

Your answer is B) <em>Arginine-Leucine-Proline-Asparagine-Lysine-Arginine</em>.

4 0
3 years ago
Which list correctly shows the flow of energy in a food chain?
ziro4ka [17]
C is the correct answer, the sun supplies energy to plant using photosynthesis, plants are eaten by humans/animals, and decompose-rs can decompose anything that is dead... hope that answer helped. C is the correct answer
6 0
4 years ago
C-Met is an oncogene that contributes to the development of certain cancers by triggering cell division and tumor growth. In a 2
trapecia [35]

Answer:

D. MicroRNA-1/206 targets c-Met mRNA for destruction via RISC.

Explanation:

microRNA's are non-coding RNA's, that is, they are not translated to proteins. MicroRNA-1/206 leads to gene silencing by 'tagging' the c-Met mRNA for cleavage by RISC proteins.

RISC: RNA-induced silencing complex is a ribonucleoprotein complex that leads to the incorporation of a single strand of micro RNA (or siRNA) that will bind to the targeted mRNA. The microRNA or siRNA strand will tag the targeted RNA for cleavage by proteins from the ribonucleoprotein. No translation will occur.

3 0
4 years ago
Only answer the questions on the right side. :)
Juliette [100K]

Genotypes [ genetic characteristics ]:

50% TT

50% Tt

Genotypic ratio:

2 : 2 : 0

Phenotypes [physical characteristics ]:

100% tall eyeballs

Phenotypic ratio:

4 : 0

Did the hospital make a mistake?

Yes, because the physical appearance of

the baby must have tall eyeballs.

No genotypes of the punnet square include a homo-zygous recessive trait.

Therefore the offspring must recieve a recessive allele from each parent to exhibit it so based on the data, it is impossible to have a baby with short eyes.

6 0
3 years ago
Other questions:
  • In a population of weasels, black (R) is the dominant color and white (W) is the other dominant trait. In weasels, fur color fol
    8·2 answers
  • Which of the following is a possible function of a protien
    8·1 answer
  • Fertilization of crops can often cause excess fertilizer to runoff into nearby
    13·1 answer
  • An enzyme known as amylase is found in the saliva of humans. This enzyme helps to begin the process of digesting starch molecule
    13·1 answer
  • The main source of carbohydrates is meat, fish, cheese, and peas. <br> a. True<br> b. False
    10·1 answer
  • In nature, individuals with successful traits pass on these trails to the next generation but unsuccessful traits are eliminated
    14·2 answers
  • Can some one help me with this
    14·1 answer
  • What is a gene?
    14·1 answer
  • AUUUAACUGUUCUGUCUAGAG
    6·1 answer
  • How many gallons of water is used for residential outdoor water each day across the united states?.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!