1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kupik [55]
3 years ago
9

If DNA has the sequence of bases TCAAGT, the mRNA formed during transcription would have the sequence of _______.

Biology
1 answer:
Brilliant_brown [7]3 years ago
5 0
It is C !! AGUUCA

simple rule ; Thymine is absent in mRNA !!
You might be interested in
Moraines left by glaciers are different from deposits left by rivers because the rocks left behind are _____.
Mama L [17]
The right answer for the question that is being asked and shown above is that: "unorganized and unsorted." Moraines left by glaciers are different from deposits left by rivers because the rocks left behind are <span>unorganized and unsorted</span>
3 0
3 years ago
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
AnnyKZ [126]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

3 0
3 years ago
In snapdragons, flower color is controlled by incomplete dominance. The two alleles are red (R) and white (r). The heterozygous
Sophie [7]

Answer:

2/4

Explanation:

50% = Rr heterozygous

50% = rr homozygous

4 0
3 years ago
Hello! Can Someone name a producer and a consumer on the right their should be the names. :)
julia-pushkina [17]
Grass would be a producer since it uses Photosynthesis to make its own food and a cow would be a consumer
5 0
3 years ago
Read 2 more answers
Is a butterfly more closely related to a worm or a bird? why?
natita [175]
Bird, for both can fly
7 0
3 years ago
Read 2 more answers
Other questions:
  • Man that last one is wrong and you spelled the first one wrong its <br> uracil and ribose
    7·1 answer
  • What is the purpose of a punnet square
    6·2 answers
  • Three species of lizard, labeled A, B, and C, are being studied using molecular analysis by two research colleagues in different
    9·1 answer
  • if a person wanted to explain the trenches at the bottom of the ocean to someone, which of the following would they include in t
    10·1 answer
  • Write two differences between the unicellular and multicellular organisms.
    13·2 answers
  • Which of the following is linked to an increase in brain size and intelligence in hominids?
    8·1 answer
  • How many food chains are in this food web?
    6·1 answer
  • which macromolecule carries out many of the functions in the cell, including catalyzing chemical reactions, transporting molecul
    5·1 answer
  • If a sample of blood reacts with anti-A antibody and clumps, but not with anti-B antibody, this blood must be of type ______.
    14·1 answer
  • What 2 scientists established the structure of dna.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!