1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
julia-pushkina [17]
3 years ago
15

Why must all living things excrete waste products

Biology
2 answers:
swat323 years ago
8 0
Remember: what goes in must come out. Living things must excrete wastes to maintain homeostasis.
Licemer1 [7]3 years ago
6 0
To basically remove the poisonous substances from the body.
to build up metabolic waste.
to help the kidney
You might be interested in
The half life of an element is 14 years how many years old The rock will be after two half-lives
alexandr402 [8]
The rock will be 28 after two half lives
3 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Suppose you examined a pedigree of a large family, going back 6 generations. In generation 5, a woman ("G5W") has a serious gene
Westkost [7]

B: A mutation in one of G5W's parents, during gamete formation, created an X-linked dominant disease allele.

You need to analyze the sex gametes.

Boys are XY

Girls are XX

If you have an X-linked dominant disease you need only one affected X gamete to have the disease.

The mother has XX' where X' is de affected and reproduce with a healthy man XY and breed unhealthy boys, but because of the heterozygous gametes you could also have healthy ones XX and XY

6 0
3 years ago
True-breeding tall plants with purple flowers are crossed to true-breeding dwarf plants with white flowers. The F1 plants were t
r-ruslan [8.4K]

Answer:b. 9 tall/purple flowers: 3 tall/white flowers: 3 dwarf/purple flowers: 1 dwarf/white flowers

Explanation:

7 0
3 years ago
L 1.4.2 Test (CST): Computer-Scored Unit Test
Helga [31]

Answer: D)  Building cars that give off less pollution!

Hope this helps!! :D

8 0
3 years ago
Other questions:
  • Which of the following are geochemical cycles important for recycling and balancing earth materials?
    10·2 answers
  • What happened to stomatal aperture width as co2 levels increased?
    13·1 answer
  • What is the structures of carbohydrates?
    11·1 answer
  • Please put each of the phrases into the categories listed below.
    15·1 answer
  • The dna of humans and mice is almost 92% Similar . This similarity indicates that . Nice have a tail , while humans have a tailb
    9·2 answers
  • Down syndrome is caused by trisomy 21, the presence of three copies of chromosome 21. The extra copy usually results from nondis
    7·1 answer
  • The environmental cue that determines the night of gamete release during a particular month is:
    12·1 answer
  • Polar bears feed on seals. So, polar bears and seals share a
    8·1 answer
  • Use the key below to report the phenotypes from the provided genotypes.
    13·1 answer
  • Why does your upper body want to keep moving when you stop running suddenly?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!