1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alinara [238K]
3 years ago
9

Los primeros en tratar de responder sobre el origen de la vida fueron los aborígenes ?​

Biology
2 answers:
damaskus [11]3 years ago
6 0

Answer:

Si creo que tienes razon

Explanation:

sí, creo que tienes razón, las indengiones fueron las primeras en especular sobre el origen de la vida.

Espero haber ayudado, por favor, márqueme como un cerebro. Que tenga un gran día <3

Simora [160]3 years ago
5 0

Se cree que los humanos emigraron al norte de Australia desde Asia en botes primitivos. Una teoría actual sostiene que esos primeros migrantes salieron de África hace unos 70,000 años, lo que convertiría a los aborígenes australianos en la población de humanos más antigua que vive fuera de África.

You might be interested in
There are some neurological differences between males and females; females are _____-brain oriented while males are _____-brain
Ede4ka [16]

Answer:

females are left-brain oriented while males are right-brain oriented.

4 0
3 years ago
Which one of Schwann's statements is no longer accepted as truth?
prisoha [69]

Answer:

D

Explanation:

3 0
3 years ago
Help me please! What type of symbiotic relationship is this?
Len [333]

Answer:

commensalism mutualism,parasitism

4 0
3 years ago
Read the information for transcription and then answer the question. Protein Synthesis Explain the process of transcription.
bagirrra123 [75]

Answer:

Please find the explanation below

Explanation:

Transcription is the first process that occurs in protein synthesis. It involves the use of the stored information in the DNA molecule to synthesize a mRNA molecule.

Transcription, which occurs in the nucleus of eukaryotes and cytoplasm of prokaryotes, is catalyzed by an enzyme called RNA polymerase. RNA polymerase binds to the double-stranded DNA and begins to unwind it (Initiation). This unwinding causes the nucleotide bases to be exposed in order for the RNA polymerase enzyme to read.

The enzyme reads the bases of the DNA and begins to synthesize RNA nucleotides using the complementary base pairing rule (Elongation) i.e. Adenine base paired with Uracil base (RNA), and Guanine paired with Cytosine etc.

The single-stranded mRNA is released at the end of the transcription process (termination). This is basically what occurs in transcription.

7 0
4 years ago
Read 2 more answers
Which has the most immediate effect on the progress of scientific research?
Bad White [126]

Answer:

The answer is: passing laws to prevent a certain type of scientific research.

6 0
3 years ago
Other questions:
  • Misting increase water loss from plant leaves while roots are forming.<br><br> TRUE<br><br> FALSE
    15·1 answer
  • How much time is needed to form most fossils
    7·2 answers
  • Why is energy needed for active transport
    15·2 answers
  • What is meant by the following statement about the cell membrane?
    6·1 answer
  • In which phase is the full illuminated face of the Moon visible on Earth?
    12·2 answers
  • Which age structure diagram shows that the number of individuals decreases
    12·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Before the glucose food can be used by a cell, it must first be transferred into an usable form of energy known as
    7·2 answers
  • Please help it’s due today and I will give brainliest!
    5·2 answers
  • What is the function of the seed (fertilized egg)?<br><br> Q#21 on pic
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!