1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sleet_krkn [62]
4 years ago
12

The cells involved in innate immunity, whose absence increases the chances of developing malignant tumors, are _____.

Biology
1 answer:
Alexeev081 [22]4 years ago
4 0

Answer:

The correct option is B (natural killer cells).

Explanation:

Natural killer cells: They are defined as the type of cytotoxic lymphocyte which are critical to the innate immune system. The NK cells play an important role in to provide rapid response to tumor formation, virus infected cells, and acting after three days of infection.

While cancer cells die, they release some antigens, than these antigens are recognized by the immune system, and later they are presented on the immune cells which are known as antigen presenting cells. So, if these cells are absent than they increase the chances of developing malignant tumors.

You might be interested in
What is a transported through a process called the water cycle
Alenkinab [10]

Answer:

Water

Explanation:

Its water because water has many forms and all those forms are being converted into other forms of water during the cycle

8 0
3 years ago
Frank is putting money into a savings account. He starts with $750 in the savings account, and each week he adds $40.
AveGali [126]

Answer:

750+(40xW)=S

750+(40x17)=----------

Explanation:

3 0
3 years ago
From which source is it thought that chloroplasts in algae originated
Mashcka [7]
They are considered to have originated from cyanobacteria through endosymbiosis—when a eukaryotic cell engulfed a photosynthesizing cyanobacterium that became a permanent resident in the cell
5 0
3 years ago
Of what is this an example? A puppy’s cells have two sex chromosomes that are the same.
WITCHER [35]
Female. If the puppy has two identical chromosomes, it would be XX, being female. 
6 0
3 years ago
Read 2 more answers
The DNA of a eukaryotic chromosome is:
lisabon 2012 [21]

Answer:

1. one long double helix.

Explanation:

  • The Eukaryotic chromosome consists of the DNA protein structural complex that is formed by a manner and permits the large amounts of the DNA to be stored in the nucleus and structure to form a double standard helix made up of the double nucleic acid molecules and exists as a complementary pair.
3 0
4 years ago
Other questions:
  • Is there any one who is preparing fo medical entrance exam
    14·1 answer
  • Choose an animal which represents a particular phylum. Briefly describe its features characteristic of its phylum including morp
    15·1 answer
  • Last one I need help with please help
    8·1 answer
  • The farming methods promoted by the California Ricelands Habitat Partnership are best described as beneficial to both farmers an
    13·2 answers
  • What is the pigment in chloroplasts that performs photosynthesis
    6·1 answer
  • How does your body ensure that the new cells are the same?
    14·1 answer
  • List all the planets of our solar system from largest to smallest orbital radius.
    7·2 answers
  • Which organisms are producers?
    6·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • True or False: Two genes on the same chromosome may become separated during meiosis.​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!