1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jolli1 [7]
3 years ago
9

What is the purpose of the coronary artery and what results if there is blockage in this vessel?

Biology
1 answer:
blondinia [14]3 years ago
3 0
The coronary artery supplies blood to the heart. if there are blockages, you will have a heart attack, since this artery supplies oxygen rich blood to the heart. Without it, the heart can die
You might be interested in
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
2 years ago
The nurse is caring for a client who has an infection spread by respiratory droplets and is in droplet precautions. the client a
Greeley [361]
"Yes, as long as your spouse wears a mask and stays at least 3 feet away from you."
3 1
3 years ago
1. What are the biotic and abiotic factors the scientists monitor which influence this
bekas [8.4K]

Answer:

biotic factor = vegetation cover and insect abundance

Explanation:

abiotic factor = ambient temperature, cloud cover, wind strength

8 0
3 years ago
Salts and sugars work to preserve foods by creating a
Ne4ueva [31]

Answer: Hypertonic Environment

Explanation:

The salt solution and sugar solution is used for the process of food preservation as the bacteria and microorganism are not able to grow in such conditions that is being created by the solution.

The amount of the solute is more and the solution is less concentrated. The bacteria cell has less solutes and more solvent.

As per osmosis the water from the salt or sugar solution moves out from bacterial cell shrinks and dies.

This is how the bacterial cell dies and the food is prevented from spoilage.

7 0
3 years ago
A new organism is discovered. What characteristics would you look at to properly classify the unknown organism? Include at least
Bumek [7]
I would look at its skin, feet, eyes
6 0
3 years ago
Other questions:
  • What are introns and exons?
    10·1 answer
  • What microscope was used to observe the first strands of dna
    6·1 answer
  • The most important factor that limits the size of a cell is _________
    15·1 answer
  • How would these animal populations be affected by the habitat destruction caused by this
    12·1 answer
  • 5. Which of the following correctly lists the kingdoms of life scientists currently use? (1 point) Terapoda, Aminota, Mammalia,
    12·1 answer
  • Some prokaryotes are able to survive unfavorable conditions by forming?
    15·2 answers
  • Choose four elements from anywhere in the periodic table. Record their masses in the table. Explain how their masses relate to e
    14·1 answer
  • an altered form of structural protein collagen causes a condition in which bones are weak and break easily. which of the followi
    7·1 answer
  • Does protein have more calories than fat
    14·1 answer
  • An a organism has a haploid number of 36. What is the organism's diploid<br> number?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!