1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tigry1 [53]
3 years ago
5

An embryo goes through different processes after fertilization. One of these processes is mitosis.

Biology
2 answers:
Yanka [14]3 years ago
8 0

Answer:

A this is a true statement

Explanation:

Sonja [21]3 years ago
3 0
The answer is A.true
You might be interested in
Which two structures contain codons and anticodons?
kupik [55]

Answer:

mRNA and tRNA

Explanation:

6 0
4 years ago
What immune system consists of immunity and humoral immunity
Iteru [2.4K]
I hope this helps u.

4 0
3 years ago
The sternal angleis the least likely part of A. the sternum to fracture in the elderly. B. occurs at the sternoclavicular joint.
Bumek [7]

Sternal angle marks the joint between the sternum and the 2nd rib.

Option E.

<h3><u>Explanation:</u></h3>

Sternum is the breast bone which is a dorsi ventrally flattened bone present in thorax of human. It gives the support for the ribs where the ribs join. A sternum has three parts - Manubrium sterni, body of sternum and the xyphoid process.

The sternum has attachments of a total of 10 ribs and clavicle. The clavicle and the first rib joins in the Manubrium sterni, and the 3rd to 10th rib joins in the body of sternum. The 2nd rib joins in a facet which is partly in Manubrium sterni and partly in body of sternum. This place id also called the sternal angle. So the sternal angle marks the joint of 2nd rib to sternum.

3 0
4 years ago
Describe two types of living things that biologists could study. Think about types of living things that are not in the ocean —
S_A_V [24]

Answer:

Following are the two types of living things that biologists could study:

1) Animals

2) Plants

Explanation:

As we know plants and animals are the most important organisms. Animals has further categories of living things are on land:

1) Birds

2) Mammals

3) Reptiles

4) Amphibians

Fishes are not included because they are in water but not on land.

3 0
3 years ago
When heterotrophs consume food (organic compounds), they convert it to usable chemical energy, primarily in the form of _______,
luda_lava [24]

Answer:

The correct answer is - ATP , glycolysis.

Explanation:

Heterotrophs are the organism, depends on other organisms for their food and energy. They get their energy when they take their food (glucose or other organic compound).

This organic compound is convert into the chemical energy or energy currency primarily, ATP during the process of glycolysis, the first stage or cycle of cellular respiration.

Thus, the correct answer is : ATP, glycolysis.

8 0
3 years ago
Other questions:
  • Differences and similarities between active transport and facilitated diffusion
    13·1 answer
  • Meiotic nondisjunction could be a result of ______
    12·1 answer
  • How does DNA help with the transfer of genetic material from parents to offspring? A. Enzymes break down DNA, releasing amino ac
    15·2 answers
  • What would have happen to an animal if all of its mitochondria disappeared?
    6·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • You have learned in class that changing the pH or temperature of the environment can denature an enzyme. When an enzyme is denat
    9·2 answers
  • The most effective way to reduce household waste would be to
    10·1 answer
  • Which type of rat is selected for in this ecosystem?
    5·1 answer
  • Please help me with the image that I am going to attach! I am very confused
    7·2 answers
  • The question is in the picture
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!