1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatyana61 [14]
3 years ago
5

Meiosis II is ______________________ division which produces _______________ nuclei in _____________________ cells for a total o

f __________________ nuclei.
Biology
1 answer:
tresset_1 [31]3 years ago
8 0

Meiosis II is reduction  division which produces four nuclei in 4 haploid cells for a total of four nuclei.

Explanation:

Meiosis 2 is the second phase of meiosis in which each diploid cell gives 2 haploid cells forming four haploid cells. It takes place in eukaryotic cells in gametes or germ cells. Sister chromatids separate in meiosis 2.

It comprises following stages:

prophase II : nuclear membrane breaks down as chromosome condense. spindle fibres get formed and microtubules prepare to grip chromosome.

metaphase II : The chromosomes are lined at metaphase plate.

Anaphase II: the sisters chromatids gets pull apart.

telophase II : nuclear memebrane is formed around each pair of chromosomes, decondensation of chromosomes occur and cytokinesis follow making four haploid cells.

You might be interested in
A nurse is caring for a client with the diagnosis of schizophrenia. during assessment the nurse identifies both positive (type i
aleksandr82 [10.1K]
There is no options to select
3 0
3 years ago
Please help it’s due soon...
lys-0071 [83]

Answer:

75%

Explanation:

7 0
3 years ago
Plagiarism Global plagiarism Incremental plagiarism Patchwork plagiarism A. using bits and pieces of other sources and passing i
nikklg [1K]

Explanation:

1. Using bits and pieces of other sources and passing it off as one’s own work

Patchwork plagiarism

In patchwork plagiarism, an author uses bits from other people's works and pass it off as their own.

2. Passing off another person’s work as one’s own

Plagiarism

The act of passing off another person's work as one's own is called plagiarism. It is a very serious offence

3. Passing off the entire work of another person as one’s own

Global plagiarism

Global plagiarism is the complete passing off of another person's own.

4. When most of the work is one’s own, but uncited sources are used

Incremental plagiarism

Here an author fails to cite the sources where he/she obtains information from.

Learn more:

Plagiarism brainly.com/question/2623994

#learnwithBrainly

7 0
3 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Explain how an oil spill devastates marine life when animals get covered by the toxic sludge.
vekshin1
Oil sticks to birds preventing them from flying. Whales and dolphins and other creatures that use blow holes can get oil into their respiratory system, making it difficult to breathe. Animals can also ingest the oil. This can be fatal and/or deadly in the short or long term.
6 0
3 years ago
Other questions:
  • A population of mice lives in a city. the largest mice tend to be killed by predators and the smallest mice cannot compete for f
    8·1 answer
  • An elements atomic number is 62. how many protons would an atom of this element have
    9·2 answers
  • Why do the cells in all living things need energy
    9·2 answers
  • What does water intensive mean
    11·2 answers
  • The five-factors for evolution are<br> gene flow, genetic drift,<br> mutation, natural selection and
    9·1 answer
  • What type of property cannot be seen just by observing with senses
    11·1 answer
  • Why is 3 the correct answer to number 4 ? Explain why please and answer this !!
    15·1 answer
  • Match the reproductive structures based on their function and the system to which they belong.
    5·1 answer
  • Please help! Thank you! :)
    8·1 answer
  • Did Napoleon manipulate the animals in Animal Farm?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!