1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MariettaO [177]
3 years ago
5

Name the four levels of group organization of living things in order of increasing complexity

Biology
1 answer:
lesya [120]3 years ago
3 0

Answer:

cell, cell tissue, organ, organ system, organism

You might be interested in
Which tho structures ate not found in animal cell
UkoKoshka [18]

The cell wall and chlorophyll are not found in animal cells.

Hope this helps!

-Payshence

6 0
3 years ago
The result of the Hershey-Chase experiment was that radioactivity could be detected inside the bacterial cells when they were in
ehidna [41]

Answer:

i belive that it is option a

Explanation:

6 0
2 years ago
BRAINLIESTTT ASAP!!!
Wittaler [7]

the common name for this is called Bryophyta

6 0
3 years ago
Read 2 more answers
Explain why it is important for dying cells to be properly removed
victus00 [196]
Cells within the body are properly arranged and their production uses up resources of the body. For example, red blood cells use iron while being produced. The body must dispose of cell properly to maintain the orderly arrangement of cells; for example, if dead skin cells were not removed, we would lose feeling in our skin due to the layer of dead cells. Moreover, the body must work to minimize wastage. This is why some of the iron from red blood cells is removed and reused.
6 0
3 years ago
Read 2 more answers
Question 1 Which term is defined as "the basic unit of structure and function found in all living things"? tissue organ organell
just olya [345]

I’m pretty sure it’s a cell

6 0
3 years ago
Read 2 more answers
Other questions:
  • We're does cinnamon grow
    15·2 answers
  • Select all that apply.
    10·1 answer
  • What characteristic do a bottleneck and a founder effect have in common? Both encounter a population crash. Both involve a porti
    5·1 answer
  • What is the function of the endoskeleton in vertebrates?
    15·2 answers
  • "46. The largest number of neurons within the brain and spinal cord are _____; they are responsible for the central nervous syst
    9·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • What type of energy has to do with a change in temperature?
    14·1 answer
  • Plants in different environments have unique challenges. For example, the growth of a plant in a rain forest (e.g., an orchid) m
    9·1 answer
  • Bro you’re literally a furry
    9·2 answers
  • Give two examples of density-dependent factors.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!