1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Effectus [21]
3 years ago
8

What percentage of water on Earth is considered freshwater? A. 2% B. 3% C. 4% D. 5%

Biology
1 answer:
MrRissso [65]3 years ago
4 0
B. only 3% of water on earth is fresh
You might be interested in
Are humans doing anything to help reverse the levels of co2 from construction
Neko [114]
Yes people are trying to plant more trees and promote awareness on afforestation and some have even started making rules the 'clean air act'
3 0
3 years ago
Thinking about the topic of cancer, write a basic science question and an applied science question that a researcher interested
RUDIKE [14]

Answer:

<u>Basic Science Questions</u>:

What is cancer.

What are the symptoms of this disease.

What will be remedy to avoid such disease.

How it will be diagnosed.

<u>Applied Science questions</u>:

How to test the cancer patient.

How the surgery takes place.

What complications might arise during a surgery.

When chemotherapy can take place.

What are side effects of having a chemotherapy.

How many types of cancer.

How to identify the stage of cancer.

Explanation:

Basic Science normally focuses on the information that is required by general public. These questions aims to explain the basic knowledge and research to the public who does not belong to medical backgrounds.

Applied Science aims to detailed and more deep research. It focuses on practical application and required every detail about a certain process. It aims to develop more practical application by application of basic research and scientific knowledge.

8 0
3 years ago
The final consumers and many food webs are
dem82 [27]
The answer to this question would be: (4)carnivoresFood made by autotrophs which makes them placed first in food webs as they produce food. After that, the herbivore can digest the food made by autotroph, makes them places as the first consumer. Carnivores is the organism that eats meat, makes them the last consumer.
7 0
3 years ago
When working with radioactive materials you must use radiation detection instruments. Which of the following instruments require
vampirchik [111]

Geiger-Muller tube is instruments requires you test three times the background of the work area.

<u>Explanation</u>:

These detectors are gas filled detectors and hence requires time for responding to the value. This time is taken because during this period it collects the electric charges and features of the electric circuit. It also gets stabilized during this period. This device has thumb rule i.e one must wait or hold for at the least 3 times the time constant before getting the precise and accurate reading. The time constant order is 10 seconds for the ionization chamber but for the Geiger counter it can vary from seconds to greater than 20 seconds

6 0
3 years ago
In a sample of double stranded dna, 30% of the nitrogenous bases are thymine what is the percentage of the nitrogenous bases in
Likurg_2 [28]
Adenine pairs with thymine. They form complementary pairs withone another during replication of the parent strand, forming the complement strand. If thymine is present for 30% of the bases, then its complement, adenine, will also be present in 30% of the bases.
3 0
3 years ago
Other questions:
  • Which type of organism creates the original source of energy for nearly every ecosystem on Earth?
    15·2 answers
  • In the process of translation, what is used to represent a specific amino acid?
    6·2 answers
  • Atp serves as a common energy source for organisms because
    9·1 answer
  • Describe how tissue fluid and lymph fluid form and explain lymph function​
    10·1 answer
  • Which of the following organelles can be best be compared to a conveyer belt
    11·2 answers
  • plz help! explain how science uses fossil evidence to support the theory of evolution. ​(I will mark brainliest)
    6·1 answer
  • Use Vocabulary
    12·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Easy biology question below first correct answer gets brainliest
    10·1 answer
  • MARKING BRAINLIEST, IMAGE ATTACHED!!!
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!