1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irina [24]
3 years ago
9

Lymphocytes that are clones of activated B cells or T cells that enhance resistance to future infection are called:

Biology
1 answer:
Nata [24]3 years ago
8 0
Maybe a? I dont know
You might be interested in
If a sexually reproducing organism has 28 chromosomes in it body cells, how many chromosome did it inherit from each parent?
nlexa [21]
14 is the correct answer. The reason being 28 divided between two parents is 14!
5 0
2 years ago
Review
lakkis [162]

Answer:it’s A

Explanation:

4 0
2 years ago
What is most likely the result of an organism having lipids in its body
bazaltina [42]

Answer:

Penguins can stay warm in cold arctic waters. It is likely the most result of an organism having lipids in its body since fats , other term for lipids, provides energy and stores it.

7 0
3 years ago
In human beings, the paternal chromosome determines the sex of the child in this way A.X
ahrayia [7]
I’m not really sure what the question is asking, but male sex chromosomes are ''XY.'' Please ask any other questions in the comment box below.
3 0
3 years ago
What does it mean to say that cells are "specialized"?
Ratling [72]

Answer:

i think the answer is B

Explanation:

Specialized means they preform a specific task.

7 0
3 years ago
Other questions:
  • Desert rabbits are adapted to the warm climate because their large ears aid in the removal of heat due to the
    8·1 answer
  • Blood returning from the body (systemic circulation) first enters which chamber of the heart?
    7·1 answer
  • _, which is released from the pituitary gland, can potentially increase the height and weight of an individual to gigantic propo
    14·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • 1. Muscles move tendons attached to bone by performing an action called _______.
    7·1 answer
  • Some scientists study the way fossils and living organisms are distributed, or spread out, on the Earth. What is this area of st
    14·1 answer
  • Plzzz hellllpppp!!!!
    10·2 answers
  • Human germ cells in the testes and ovaries begin with 46 chromosomes (23 pairs). How many does
    11·2 answers
  • What happens to DNA once transcription is done?
    12·1 answer
  • Which letter in Figure 1 represents meiosis? Why?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!