1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AysviL [449]
3 years ago
6

A bacterial cell is suddenly expelled from a warm human intestine into the cold world outside. Which one of the following adjust

ments might the cell make to maintain the same level of membrane fluidity that the cell had in the intestine?a. increase the length of the hydrocarbon tails in its membrane phospholipids.
b. increase the proportion of unsaturated hydrocarbon tails in its membrane phospholipids.
c. increase the proportion of hydrocarbon tails with no double bonds in its membrane phospholipid.
d. decrease the amount of cholesterol in the membrane.
Biology
1 answer:
xxMikexx [17]3 years ago
5 0
<h2>Answer is option "b"</h2>

Explanation:

  • Composed of a phospholipid bilayer with installed proteins, the plasma layer is specifically penetrable to particles and natural atoms and directs the development of substances all through cells. Plasma films must be truly adaptable so as to permit certain cells, for example, red platelets and white platelets, to change shape as they go through restricted vessels.
  • The plasma membrane additionally assumes a job in securing the cytoskeleton to give shape to the phone, and in joining to the extracellular grid and different cells to help bunch cells together to frame tissues. The layer likewise keeps up the cell potential
  • Hence the right answer is option b "increase the proportion of unsaturated hydrocarbon tails in its membrane phospholipids"

You might be interested in
Heart disease is a noncommunicable disease because
tatuchka [14]

The right answer is it can be influenced by lifestyle factors.

Noncommunicable diseases - or chronic diseases - are long-term diseases of generally slow evolution. The 4 main types of noncommunicable diseases are:

* Cardio-vascular diseases (or heart diseases)

* cancers

* Chronic respiratory diseases (COPD and asthma)

* Diabetes

Noncommunicable diseases, or NCDs, are by far the leading cause of death in the world, accounting for over 63% of all annual deaths.

7 0
4 years ago
Read 2 more answers
Consider these two characteristics.
soldier1979 [14.2K]

Answer:

the face is inherited  the scat is a trait

Explanation:

you would be born with your face shape but not a scar

4 0
3 years ago
Read 2 more answers
A homeotic gene is
faust18 [17]

Answer:

represses gene transcription and promotes mRNA translation.

Explanation:

Homeotic gene refers to any group of genes that controls the pattern of formation of body structure during early embryonic development of organisms. These genes encode proteins which is called transcription factors that direct cells to form various parts of the body. Homeotic genes is the master control genes that regulate other groups of genes that are responsible for the development of body parts that will develop in different locations.

7 0
3 years ago
In a food web, a hawk would most likely eat:
Whitepunk [10]
My best response would Mice and rabbits, which is the last one
3 0
4 years ago
Read 2 more answers
What does this information mean in terms of dating the mystery layer?
GalinKa [24]

Geologists can 'read' rock layers using relative and absolute dating techniques. ... Relative dating arranges geological events, and the rocks they leave behind, in a sequence. The method of reading the order is called stratigraphy (the rock layers are called strata).

3 0
3 years ago
Read 2 more answers
Other questions:
  • Some structures related to fungi include hyphae and mycellium. Which statement BEST explains how these structures are related?
    14·2 answers
  • Human activity has the greatest effect on global climate change when it results in which of the following
    11·1 answer
  • 1.What weakens coral exoskeletons?
    10·1 answer
  • Examine the incomplete graphic pictured above. Which label belongs in box 3?A-Fungi B-Protista D-Eubacteri C-Eukarya Will give B
    15·1 answer
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • The most serious consequence of acute pancreatitis resulting from biliary obstruction is:________
    13·1 answer
  • List the order in which your body will break down and use the biomolecules for energy
    6·1 answer
  • What are the processes that produce protein of DNA? simple word will do i dont need a long answer ​
    9·1 answer
  • One of the seed banks has been storing seeds of a rare and endangered plant to keep the seeds fresh.120 of the seeds of this pla
    7·1 answer
  • In a laboratory study, antibiotic resistance was shown to arise in populations of lab-grown bacteria in as few as twenty generat
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!