1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zigmanuir [339]
3 years ago
7

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct

catccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for?
Biology
1 answer:
Orlov [11]3 years ago
3 0
A gene instructs for the making of protein molecules.
Please make brainliest!☺
You might be interested in
One person is pushing a cart with a force of 300 units to the right. Another person is
Helen [10]

Answer:

The answer is 150 units to the left.

Explanation:

You start with the bigger number and subtract it because they ´re going opposite directions. It goes to the left because your net force will go in that same direction with the bigger number.

450 - 300 = 150 units to the left

I hope this helps u! :D

4 0
3 years ago
Read 2 more answers
What shows the pathway of the egg through the reproductive system?
34kurt

its d for shure because it comes from the oveares first when its created the egg



5 0
4 years ago
Read 2 more answers
Some parts of DNA do not code for proteins. Describe how non- coding parts of DNA can affect the expression of genes​
love history [14]

Answer:

By altering one of these regions, a variant (also known as a mutation) in noncoding DNA can turn on a gene and cause a protein to be produced in the wrong place or at the wrong time. Alternatively, a variant can reduce or eliminate the production of an important protein when it is needed.

Explanation:

7 0
3 years ago
Frequent changes in cause rock formations
steposvetlana [31]

Answer:

Okay I never know that thanks

3 0
3 years ago
True or False? Organelles such as the mitochondria and the golgi apparatus are found floating around in the cytoplasm in the cel
Alexus [3.1K]

Answer:

True

Mitochondria and goigl apparatus are found floating around in the cytoplasm in the cell.

7 0
3 years ago
Other questions:
  • Cell organelles can be seen with a light microscope true or false
    5·2 answers
  • Why is a soil profile in a tropical rain forest different from one in a desert?
    12·1 answer
  • Which types of cells are not capable of regeneration?
    6·1 answer
  • What are some environmental factors (stimuli) that organisms respond to?
    13·1 answer
  • Which statements belong to Dalton’s atomic theory? Select four options.
    9·1 answer
  • Which statement is true about microevolution?
    10·1 answer
  • What unique characteristic do all deuterostomes have in common???
    15·1 answer
  • A photon from the sun hits chlorophyll and excites an electron, known as _______ .
    8·1 answer
  • Two students want to go on a night hike when there is a full moon In July. July Sun. Mon. Tues. Wed. Thurs. Sat. 4 S 7 9 10 11 1
    9·1 answer
  • PLEASE HELP ME BEFORE I FAIL THE 6TH QUIZ THIS YEAR
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!