1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zigmanuir [339]
3 years ago
7

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct

catccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for?
Biology
1 answer:
Orlov [11]3 years ago
3 0
A gene instructs for the making of protein molecules.
Please make brainliest!☺
You might be interested in
What is the meaning of the term founder effect?
soldi70 [24.7K]

Answer:

between a an b, but I think it's a

Explanation:

the reduced genetic diversity which results when a population is descended from a small number of colonizing ancestors.

7 0
2 years ago
Read 2 more answers
The muscular system and the skeletal system are two different organ systems, but they’re often referred to jointly as the muscul
Natali [406]

Answer:

(for 1st question)

Plato's answer: This world exists because both systems are involved in the movement and support of the body, and they work together to perform these functions. Bones provide support and give the body structure. Muscles give strength, and the contraction and relaxation of muscles allow for different movements.

Explanation:

Another Answer: The muscular system is responsible for the movement of the human body. Attached to the bones of the skeletal system are about 700 named muscles that make up roughly half of a person's body weight. Each of these muscles is a discrete organ constructed of skeletal muscle tissue, blood vessels, tendons, and nerves.

6 0
2 years ago
5. Dieting often leads to weight gain.<br> True<br> False
vagabundo [1.1K]

Answer:

the answer is false. Dieting usually leads to weight loss.

7 0
3 years ago
Photosynthesis reactants
maw [93]

Answer:

The reactants for photosynthesis are light energy, water, carbon dioxide and chlorophyll, while the products are glucose (sugar), oxygen and water.

5 0
3 years ago
Read 2 more answers
Four samples of the same material with identical composition and mass were cut as shown in the diagrams below.
Minchanka [31]

Answer:

D

Explanation:

Sample D will undergo the fastest rate when subjected to chemical weathering.

What is weathering?

  • It is the physical disintegration and chemical decomposition of rocks to form sediments and soils.
  • Physical weathering is also known as mechanical weathering. It entails breaking rocks into smaller sized chunks.
  • Chemical weathering is the decomposition of rocks by chemical action.

From the given choices, option D will have the largest surface area exposed to chemical actions. It has more surface area compared to the others. The more broken a mass is, the more its surface area is.

Reaction rates are affected by:

  • Increase in surface area
  • Increase in temperature
  • Higher concentration
  • Increase in pressure

The last cube has the highest surface area and will have the fastest rate of weathering.

3 0
4 years ago
Other questions:
  • Why does the environmental crisis demand a new ethic?
    6·1 answer
  • A food handler is permitted to work with highly susceptible populations without prior approva from the local reluatory authorty
    6·2 answers
  • In diploid organisms, having two homologues of each chromosome can be beneficial if one allele of a gene encodes a nonfunctional
    11·2 answers
  • Around week eight, the embryo becomes a ________. The kidneys, liver, brain, and lungs are all beginning to function. The finger
    12·1 answer
  • One advantage of meiosis is
    10·2 answers
  • Vesicular breathing sounds probably result from ________.
    15·1 answer
  • During the process of___ gas loses heat wnd changes into a liquid​
    7·1 answer
  • 5.
    5·1 answer
  • what plant materials are delicate and susceptible to attack by various pests and diseases as well as weather conditions?​
    8·1 answer
  • Which explanation describes why mates are more likely to exhibit sex-linked disorders than temales?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!