1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lora16 [44]
3 years ago
5

During DNA replication, a DNA strand that has the bases GGTCTA produces a strand with the bases

Biology
2 answers:
Natasha2012 [34]3 years ago
7 0
CCAGAT , or B.

The reason why is because A only pairs with T, and G only pairs with C. So, if you have a strand with GGTCTA, the only possible pairing for that to replicate is CCAGAT.
Liula [17]3 years ago
4 0

Answer:

CCAGAT

Explanation:

DNA consists of two base pairs one is purine and another is purine. The A and G are purines and T, C are pyrimidines. During the  DNA replication A combined with T, and C combines with G. These are called complementary pairing. Therefore, a DNA strand that has bases GGTCTA produces a strand with the bases CCAGAT

You might be interested in
Which of the following stages of cellular respiration involve cytochromes?
larisa86 [58]

Answer:

A. III only

Explanation:

Cytochromes are found only in the mitochondrial membrane as part of the electron transport chain. They are vital to the downward cascade of energy as electrons are passed from the NAD+ and FAD produced during glycolysis and the Krebs cycle into the electron transport chain to eventually produce ATP.

3 0
3 years ago
Consider two very distantly related species, Species A and Species B. These species live in distinct but similar environments an
never [62]

Answer:

convergent evolution

Explanation:

If we have two species that share a similar trait or look alike a lot, but they live in places isolated from each other, and they only have a very distant relation, then it is a case of convergent evolution. This type of evolution occurs with species that are not closely related, but they live in environments where having the same or very similar traits is advantageous. This can often lead to a confusion when looking at the species only on the outside, and it can be very misleading. As an example we can take the sabretoothed predators that existed in the past. Both the smiloden and the thylacosmilus had large saber like teeth, and even their bodies looked very similar, so one would assume that they are closely related, but that was not the case. The smilodon was part of the cat family, while the thylacosmilus was a marsupial, making them very distantly related. They developed same same and some very similar traits because their environment created the evolutionary pressure for those traits to develop as they were advantageous, despite them evolving in totally different places and separately.

8 0
3 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
1. Digital signals carry less information per second.
DENIUS [597]

Answer:

2. Information can be stored for future recovery.

3. Digital signals can be transmitted over long distances.

Explanation:

This world is moving towards digitalization. The digital signals are able to transmit the data over long distance. This has squeezed the world information and the data are run to distant places within seconds. The information on digital signals can be stored for later use.

5 0
3 years ago
Can someone help me <br> A. Enzyme<br> B. Starch<br> C. Oil<br> D. DNA
Sphinxa [80]

Answer:

The answer is A. Enzyme

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • A red bird and a blue bird mate, and their offspring are purple in color. What type of inheritance is this? A. Codominance B. In
    11·2 answers
  • What is used to determine the actual age of rock
    13·1 answer
  • The observations of hooke and van leeuwenhoek documenting the existence of microscopic cells formed the basis of what important
    6·1 answer
  • John wants to test how tempreture affects the mass of sugar that can be dissolved in water. which of the following must be the s
    15·1 answer
  • Are mitochondria found in animal cells
    6·2 answers
  • Which of these changes is a benefit of using only nonpolluting sources of electricity?
    5·1 answer
  • What is the habitat of the starfish and what does it eat
    9·1 answer
  • How are plants pull toward the sun
    14·1 answer
  • T or F<br> An invasive species will cause an ecosystem to reach carrying capacity<br> faster
    5·1 answer
  • Adenine A will pair up with Guanine G, and Cytosine C will pair up with Thymine (T) on a strand of DNA.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!