Answer:
A. III only
Explanation:
Cytochromes are found only in the mitochondrial membrane as part of the electron transport chain. They are vital to the downward cascade of energy as electrons are passed from the NAD+ and FAD produced during glycolysis and the Krebs cycle into the electron transport chain to eventually produce ATP.
 
        
             
        
        
        
Answer:
convergent evolution
Explanation:
If we have two species that share a similar trait or look alike a lot, but they live in places isolated from each other, and they only have a very distant relation, then it is a case of convergent evolution. This type of evolution occurs with species that are not closely related, but they live in environments where having the same or very similar traits is advantageous. This can often lead to a confusion when looking at the species only on the outside, and it can be very misleading. As an example we can take the sabretoothed predators that existed in the past. Both the smiloden and the thylacosmilus had large saber like teeth, and even their bodies looked very similar, so one would assume that they are closely related, but that was not the case. The smilodon was part of the cat family, while the thylacosmilus was a marsupial, making them very distantly related. They developed same same and some very similar traits because their environment created the evolutionary pressure for those traits to develop as they were advantageous, despite them evolving in totally different places and separately.
 
        
             
        
        
        
Answer:
After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is 
Explanation:
  1. AACGTACGATCGATGCACATGCATGGCTACGC
 Complementary strand  
      TTGCATGCTAGCTACGTGTACGTACCGATGCG
Protein encode: NVRSMHMHGY
  2. CCCGGGTATGCATGTACGTACGTCGTATATCG
 Complementary strand  
      GGGCCCATACGTACATGCATGCAGCATATAGC
Protein encode: PGYACTYVVY
3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT
Complementary strand  
    GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA
Protein encode: RDRAIDECLV
4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG
Complementary strand  
    AATTTGCTCGACGATCGATAAAAATTTTGGGGC
Protein encode: LNELLAIFKTP
 
        
             
        
        
        
Answer:
2. Information can be stored for future recovery.
3. Digital signals can be transmitted over long distances.
Explanation:
This world is moving towards digitalization. The digital signals are able to transmit the data over long distance. This has squeezed the world information and the data are run to distant places within seconds. The information on digital signals can be stored for later use.