Answer;
B) Neurons, epithelial cells
Explanation;
-Primary lateral sclerosis (PLS) is a rare neuromuscular disease with slowly progressive weakness in voluntary muscle movement. PLS belongs to a group of disorders known as motor neuron diseases. PLS affects the upper motor neurons (also called corticospinal neurons) in the arms, legs, and face.
-It occurs when nerve cells in the motor regions of the cerebral cortex (the thin layer of cells covering the brain which is responsible for most higher level mental functions) gradually degenerate, causing movements to be slow and effortful. The disorder often affects the legs first, followed by the body, trunk, arms and hands, and, finally the bulbar muscles (muscles that control speech, swallowing, and chewing).
Answer:
water is constantly moving across the earth. The water is strong enough to break down soil in tiny pieces. What’s happening is a process called erosion. Erosion is: the process of eroding or being eroded by wind, water, or other natural agents.
"the problem of soil erosion".
Water also carries sand and moves it around, this obviously changes the shape of the earths surface!
Explanation:
Answer:
A lysosome is a membrane-bound cell organelle that contains digestive enzymes. They break down excess or worn-out cell parts. They may be used to destroy invading viruses and bacteria. If the cell is damaged beyond repair, lysosomes can help it to self-destruct in a process called programmed cell death, or apoptosis.
Explanation:
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
He showed that flies did not grow from meat that was not exposed to air
