1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
creativ13 [48]
3 years ago
13

What type of electrical energy is used in homes and businesses in California and is produced from the heat energy of magma close

to the earth's surface?
A) oil
B) coal
C) geothermal
D) natural gas
Biology
2 answers:
MAXImum [283]3 years ago
6 0

A oil it’s simple google it

zaharov [31]3 years ago
4 0

Answer: C

Explanation:

You might be interested in
The latitudes in this biome have evenly distributed precipitation throughout the year.
jasenka [17]
Answer- Lower latitudes of Coniferous Forests.

In the lower latitudes of coniferous forests, precipitation is more evenly distributed throughout the year. This Biome can be found in Canada, Europe, Asia, and the United States; they mostly consist <span>consist of conifers (trees that grow needles and cones instead of leaves and flowers respectively).</span>
5 0
3 years ago
Read 2 more answers
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
What percentage of water on Earth is fresh water?<br> 7<br> 3<br> 18<br> 0.5
AveGali [126]
3% of the Earth's water is freshwater.<span />
5 0
3 years ago
Read 2 more answers
Mrs. Jones who has dementia. She continues to ask for her husband, whom you know passed away several years ago. How would you as
wlad13 [49]

Answer:

You tell her that her husband is away and will be coming back later

Explanation:

If you tell her he's dead, she won't believe you so just go along with it.

3 0
3 years ago
Examine the diagram of a cell.
JulsSmile [24]

Answer:

Explanation:

This is golgi body

4 0
3 years ago
Read 2 more answers
Other questions:
  • How do systems in organisms prove that organisms are related?
    12·1 answer
  • One method for separating polypeptides utilizes their different solubilities. The solubility of large polypeptides in water depe
    13·1 answer
  • Describe the structure of the layers of the skin (pp.178-184)
    11·1 answer
  • Nathaniel is visiting his city's plant conservatory, which is a giant old greenhouse. He notices that there is condensation on t
    5·2 answers
  • Which of the following events normally activates a GTP-binding protein?a).GTP hydrolysis by the protein Activation of an upstrea
    6·1 answer
  • How can understanding gene expression(protein synthesis) impact our lives?
    8·1 answer
  • What condition does the endocrine system works to produce
    8·1 answer
  • Tissue specific gene regulation is primarily controlled by
    8·1 answer
  • Stegosaurus and ankylosaurus are united in a group called
    15·1 answer
  • Sharon was an abused child; as an adult, she is homeless and squanders any money she can find on alcohol. alfred adler would hav
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!