1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Allisa [31]
3 years ago
10

4. what is the p-wave shadow zone and what causes it

Biology
1 answer:
PolarNik [594]3 years ago
8 0

The shadow zone is the area of the earth from angular distances of 104 to 140 degrees from a given earthquake that does not receive any direct P waves. The shadow zone results from S waves being stopped entirely by the liquid core and P waves being bent (refracted) by the liquid core.

You might be interested in
Which is an example of a polygenic trait?
max2010maxim [7]

Answer:

Polygenic traits are traits that are controlled by multiple genes instead of just one. The genes that control them may be located near each other or even on separate chromosomes. Some examples of polygenic traits are height, skin color, eye color, and hair color.

8 0
3 years ago
Read 2 more answers
Drag each label to the correct location on the image.
sladkih [1.3K]

Answer:

producer: grass, primary: grasshopper, secondary: frog, tertiary: snake

Explanation:

3 0
2 years ago
What do MSDS sheets do?
egoroff_w [7]

Answer:

The MSDS lists the hazardous ingredients of a product, its physical and chemical characteristics (e.g. flammability, explosive properties), its effect on human health, the chemicals with which it can adversely react, handling precautions, the types of measures that can be used to control exposure, emergency and first....

Explanation:

thats basically what they are lol yea okay yea no

5 0
3 years ago
Hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
Firlakuza [10]

hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh

4 0
3 years ago
Read 2 more answers
Which parts of the nervous system would send messages from a person’s sore knee to alert him or her to stop running and rest?
goblinko [34]

Answer:

i believe nuerons

Explanation:

because they tell your brain whats happening and send messages to your other parts of you body on what to do

7 0
3 years ago
Other questions:
  • Karie read the following definition of the term scientific method: "the series of steps that scientists use to answer questions
    6·2 answers
  • The most common inherited blood disorder in the united states is
    14·1 answer
  • What is like ants and bee that are invertebrates
    10·2 answers
  • A hygrometer is used to measure ____________, and its measurements will differ between climate zones.
    15·1 answer
  • How is water evaporated around the world
    10·1 answer
  • Biology i need some help
    7·1 answer
  • How can scientists learn about the mantle if they cannot study it directly?
    7·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • HELP!!!!!!!
    11·2 answers
  • State the " Central Dogma of Biology"​
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!