1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MArishka [77]
3 years ago
10

Which is the most accurate representation of the organization levels of the genetic information in cells?

Biology
1 answer:
vesna_86 [32]3 years ago
7 0

Answer:

An adequate way in biology has classified and ranked the levels of organization of genetic information

1. DNA: refers to the double helix.

2. Nucleosomes: they are the first level of DNA curl. They are formed by a protective core of 8 histones, around which the double helix of DNA is inscribed.

3. Chromatin: is the set of nucleosomes, is composed of histones, other DNA and RNA proteins

4. Chromosome: it is the condensed chromatin

You might be interested in
1 Which observation could lead to the conclusion
OlgaM077 [116]

Answer: 4

Explanation:

It is composed of a cell, but does not have

tissues.

5 0
3 years ago
Read 2 more answers
When cells communicate by the signaling process, one cell produces a _________________BLANK that must be received by the _______
velikii [3]

Answer:

1. Signaling molecule

2. Signaling receptors

Explanation:

Hormones, growth factors, neurotransmitters, etc. serve the function of signaling molecules for cells. These molecules are released by one cell and bind to the receptors present on/in the target cells to elicit the desired response. Thereby, the signaling molecules serve in cell-cell communication.

For example, insulin hormone synthesized and released from beta cells of pancreas binds to its cell surface receptors present on the surfaces of liver cells and muscle cells to stimulate the uptake of the glucose from the blood.  

Likewise, neurotransmitters released from the presynaptic neuron bind to receptors present on the membrane of postsynaptic neuron and serve to carry the nerve impulse to the postsynaptic neuron.  

8 0
2 years ago
What are the different steps to cellular respiration?
Lina20 [59]

Answer:

Steps to cellular respiration:

1) In the first step of respiration, glycolysis occurs in which glucose molecule is converted into pyruvate molecule.

2) Krebs cycle is also called citric acidity cycle. In this cycle, hydrogen and electron are produced from the oxidation of pyruvate molecule and provides to electron transport chain.

3) Electrons carried by NADH + H and FADH2 are converted into oxygen through a series of electron carriers, and production of ATP occurs.

7 0
3 years ago
Please select the word from the list that best fits the definition
yanalaym [24]

Answer:

A.

Explanation:

Proteins

7 0
3 years ago
What causes water molecules to stick together in liquid water?
Nana76 [90]

Answer:

A. Hydrogen bonds

Explanation:

A. Hydrogen bonds causes water molecules to stick together in liquid water.

8 0
2 years ago
Read 2 more answers
Other questions:
  • 10 Points
    5·2 answers
  • the process of organizing and condensing DNA into its compact form so that it can divide takes place at the start of
    12·1 answer
  • What kind of information is carried by the ventral roots of the spinal cord?
    10·1 answer
  • When explaining dominant and recessive traits to a younger family member, they respond, "Well chances are I can probably taste P
    15·2 answers
  • gets BRAINILIST pls help need major help litarlly crying for help pls help me pls It question 11 of critical thinking 6th of 1.1
    9·1 answer
  • Granite is an example of _____ igneous rock that forms deep beneath Earth’s surface.
    13·2 answers
  • Which statement best describes this role of plastids in the plant cell
    13·1 answer
  • is it possible to get pregnant a woman if she have a very small egg cell? in comparison a normal egg cell would be like a size o
    10·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What is the only bone not connected to any other bone?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!