1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vlabodo [156]
2 years ago
13

What are two ways that proteins can impact the cell cycle and cause cancer

Biology
1 answer:
Sliva [168]2 years ago
8 0

Answer:

there can be mutations in the cell cycle that cause uncontrollable growth in the cells.

and this can cause tumors in the body with the uncontrollable growth of the cancer cells

You might be interested in
Why is an electron microscope unsuitable to study living cells?
kari74 [83]
You can't use it because the living cells won't be able to handle the high vacuum conditions.
Hope this helped ;)
8 0
3 years ago
What does it mean when a compound’s chemical formula does not include any numbers? A. There are only single bonds in the molecul
yaroslaw [1]

Answer:

B

Explanation:

This number that is put in a compound is called a subscript. It is put in front of the symbol of the element being represented. An example is CO₂ which means there are one (1) carbon and two (2) oxygen atoms in the compound.

3 0
3 years ago

 3. Compare the amount of energy that can be stored in ATP and glucose. How does the cell use each of these molecules to store
bogdanovich [222]
<span>3. Cells use glucose to store large amounts of energy for long period of time. 
In contrast, ATP is used to </span>store smaller amounts of energy that will be used in the next few seconds.<span>
A glucose molecule can store more than 90 times the energy of a ATP molecules.

4. The fact that the potted plant is in air tight jar affect the process of photosynthesis. The plant is airtight jar which means that the plant is not able to breath and run out of CO2 to produce sugars. So t</span><span>he plant wouldn't be able to complete photosynthesis.</span>
5 0
3 years ago
Which of the four species of plasmodium is the most dangerous?
natali 33 [55]
Plasmodium falciparum
7 0
3 years ago
Small, flat bone that is also known as the kneecap:
Lyrx [107]
Patella is the word you are looking for
5 0
3 years ago
Other questions:
  • ________ is a combination of rain, snow, dust, and other particles with a ph lower than 5.6.
    5·1 answer
  • With a patient that is administered an injection of erythropoietin (epo) you would expect to see ________.
    8·1 answer
  • True or false carbohydrates also make up part of the cell membrane
    11·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Why was ice used during the extracting DNA
    13·1 answer
  • In a process known as deforestation, humans cut down millions of trees every year to build houses, generate energy, and make pap
    7·2 answers
  • The main difference between commercial and noncommercial operations is
    15·1 answer
  • 1. Restriction enzymes are
    7·1 answer
  • If an eclipse were to last for days what effects might have on plants and wildlife
    12·1 answer
  • 13. What animals belong in this class of crustaceans? Branchiopoda
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!