1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Maurinko [17]
3 years ago
8

What takes charge of the body's involuntary functions outside conscious awareness

Biology
1 answer:
uranmaximum [27]3 years ago
3 0
It is the central nervous system that takes charge of the body's involuntary functions outside conscious awareness. It is this system that is responsible for all of the body's involuntary acts, such as breathing, blinking, etc. 
You might be interested in
A population of squirrels living in a little habitat covering 150 hectares is at 80% of the carrying capacity of 1500. Assuming
Kay [80]
Population density  =number  of   individual  divided  land  area
land  area  should  be  in  square kilometers
therefore 120  ha  =120  x0.01=1.2 square kilometer  since   1 ha=0.01  kilometer  square
total  population=  (80  x  1500)/100=1200
population  density   is therefore=1200/1.2=1000
7 0
3 years ago
Read 2 more answers
The __________ endoplasmic reticulum manufactures lipids and carbohydrates where as the __________ endoplasmic reticulum assists
Arada [10]

The smooth endoplasmic reticulum manufactures lipids and carbohydrates.

The Rough endoplasmic reticulum assists in the synthesis of proteins and send them to the Golgi bodies.

What is the endoplasmic reticulum?

The endoplasmic reticulum (ER) is a continuous membrane structure that divides into flattened sacs in the cytoplasm of eukaryotic cells. It has a variety of roles but is notably crucial for protein synthesis, folding, modification, and transport.

  1. Rough endoplasmic reticulum: Its name comes from the rough texture of its outer (cytoplasmic) surface, which is caused by the presence of ribosomes there. Rough ER is located next to the cell nucleus, and the nuclear envelope's outer membrane is continuous with its membrane.
  2. Smooth endoplasmic reticulum: It is distinct from ribosomes and has a different set of functions. The synthesis of lipids, including as cholesterol and phospholipids, which are needed to create new cellular membranes, is carried out by the smooth ER. Smooth ER is crucial for the synthesis of steroid hormones from cholesterol in certain cell types.

To learn more about endoplasmic reticulum visit the link:

brainly.com/question/13118914?referrer=searchResults

#SPJ4

5 0
1 year ago
Pythagoras's Model has the sun in center of the universe.<br> True<br> False
Basile [38]

Answer:

i think its false, i checked wikipedia and it says that he thought the sun revolved around a "central fire"

Explanation:

5 0
3 years ago
Which term is most synonymous with the word autotroph?
MrMuchimi

Answer: it should be producer

6 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Other questions:
  • PLEASE ANSWER THESE QUESTIONS COMPLETELY!!! WILL MARK BRAINLIEST!!!
    14·1 answer
  • Which of the following is a characteristic of a typical carbon atom?
    7·2 answers
  • In sigmund freud's theory, the _______ operates according to the pleasure principle. (1 point)
    14·1 answer
  • Igneous rock turns into a metamorphic rock by...
    8·1 answer
  • A bean plant is heterozygous for seed shape. Its seeds are smooth.
    10·2 answers
  • . According to the concept of entropy, what will likely happen to most molecules over time? (Points : 3) . -They will break down
    6·2 answers
  • !!!!!!!!!!PLEASE ANSWER QUICK!!!!!!!!!!!WILL MARK BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    8·1 answer
  • You wanted to prepare a fish dish for your grandfather that he loves the dried salted Codfish. But
    5·1 answer
  • PLZ HELP IM TIMED
    10·2 answers
  • What is one effect the hydrosphere has on the lithosphere 1).Erosion of rocks 2).Evaporation of water 3).Heating of the core 4).
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!